A revision of Malagasy species of Anochetus Mayr and Odontomachus Latreille (Hymenoptera: Formicidae). Author Fisher, B. L. Author Smith, M. A. text PlosOne 3 1 23 2008 Anochetus boltoni Anochetus goodmani Anochetus pattersoni 21401 http://hdl.handle.net/10199/15447 A Revision of Malagasy Species of Anochetus Mayr and Odontomachus Latreille (Hymenoptera: Formicidae) Brian L. Fisher1*, M. Alex Smith2* 1 Department of Entomology, California Academy of Sciences, San Francisco, California, United States of America, 2 Biodiversity Institute of Ontario, University of Guelph, Guelph, Ontario, Canada Abstract Species inventories are essential for documenting global diversity and generating necessary material for taxonomic study and conservation planning. However, for inventories to be immediately relevant, the taxonomic process must reduce the time to describe and identify specimens. To address these concerns for the inventory of arthropods across the Malagasy region, we present here a collaborative approach to taxonomy where collectors, morphologists and DNA barcoders using cytochrome c oxidase 1 (CO1) participate collectively in a team-driven taxonomic process. We evaluate the role of DNA barcoding as a tool to accelerate species identification and description. This revision is primarily based on arthropod surveys throughout the Malagasy region from 1992 to 2006. The revision is based on morphological and CO1 DNA barcode analysis of 500 individuals. In the region, five species of Anochetus ( A. boltonisp. nov. , A. goodmanisp. nov. , A. grandidieri , and A. madagascarensis from Madagascar, and A. pattersonisp. nov. from Seychelles) and three species of Odontomachus ( O. coquereli , O. troglodytes and O. simillimus ) are recognized. DNA barcoding (using cytochrome c oxidase 1 (CO1)) facilitated caste association and type designation, and highlighted population structure associated with reproductive strategy, biogeographic and evolutionary patterns for future exploration. This study provides an example of collaborative taxonomy, where morphology is combined with DNA barcoding. We demonstrate that CO1 DNA barcoding is a practical tool that allows formalized alpha-taxonomy at a speed, detail, precision, and scale unattainable by employing morphology alone. Citation: Fisher BL, Smith MA (2008) A Revision of Malagasy Species of Anochetus Mayr and Odontomachus Latreille (Hymenoptera: Formicidae). PLoS ONE 3(5): e1787. doi:10.1371/journal.pone.0001 787 Editor: James Trager, Missouri Botanical Garden, United States of America Received November 8, 2007; Accepted February 11, 2008; Published May 28, 2008 Copyright: A © 2008 Fisher, Smith. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: Funding for the research was provided to BLF by WWF-US and National Science Foundation under Grant No. INT 9998672 and DEB-0344731, and a Fonds quebecois de la recherche sur la nature et les technologies B3 postdoctoral fellowship to MAS. Laboratory analyses were graciously supported by grants to P.D.N. Hebert from the Gordon and Betty Moore Foundation, Genome Canada through the Ontario Genomics Institute, the Canada Foundation for Innovation, the Ontario Innovation Trust and NSERC. Competing Interests: The authors have declared that no competing interests exist. * E-mail: bfisher@calacademy.org (BLF); salex@uoguelph.ca (MAS) Introduction Anochetus and Odontomachus were treated globally by Brown [1,2]. This paper revises the genera for the Island of Madagascar and also includes new records from the Seychelles and Comoro Islands. The revision is based on morphological and CO1 sequence analysis of 500 individuals. We evaluate the role of DNA barcoding as a tool to accelerate species identification and description. Anochetus and Odontomachus are closely related genera [1,3,4] characterized by long and straight mandibles inserted just on either side of the cephalic midline and with two or three large teeth near tip arranged in a vertical series (Figure 1a,b). The single tooth or spine at the apex of the petiole separates Odontomachus from the closely related genus Anochetus (which has two teeth or rounded margin). Odontomachus and Anochetus can also be easily distinguished by the characters on the back of the head. With head viewed from back near neck of pronotum, Odontomachus has dark, inverted V- shaped apophyseal lines that converge to form a distinct, sometimes shallow groove or ridge on upper back of head. In Anochetus , the V-shaped apophyseal lines are absent. In the same region of the back of head, however, nuchal carinae in Anochetus form an uninterrupted, inverted U-shaped ridge. In the field, small members of Anochetus might also be mistaken for Strumigenys , from which they may be distinguished by their one-segmented waist (vs. two segments in Strumigenys ). The utility of a standardized single gene for species recognition (but not phylogenetics) has been tested in an increasing swath of life. Here we tested how well a cytochrome c oxidase 1 (CO1) DNA barcode resolved species within Malagasy Anochetus and Odontomachus . In Madagascar, these ponerine genera are known to include species with independent colony formation by ergatoid (wingless) queens - and therefore are expected be a challenge for DNA barcoding using a single mitochondrial marker - but also include cases where prior taxonomy has not linked males with females and workers, nor has resolved obvious worker dimorphism as either caste variation or provisional species. Species level taxonomy in these genera can be quite difficult. Brown [2] noted that males provide a useful source for species level delimitation. Males, however, are rarely associated with the worker castes. Brown [2:553] states: ''Unfortunately, males found associated in the nest with the female castes are known only for a minority of the species. Additional kinds of males are known from collections at light or by Malaise trap, but it has not yet been possible to link any of these securely to worker-based species.'' In this study, we used CO1 barcode sequences to associate worker, queen and male castes. We conclude that DNA barcoding will enable species delimitation, linking a greater range of the morphological diversity in ants (castes and sex), and further will provide a set of molecular characters that improve species delimitation and identification while making these hypotheses transparent and reproducible. Methods This revision is primarily based on arthropod surveys in Madagascar that included over 6,000 leaf litter samples, 4,000 pitfall traps, and 8,000 additional hand collecting events throughout Madagascar from 1992 through 2006 [5]. Also included are specimens from museums in Genoa, Geneva, Paris, London, Berlin, Tervuren, and Basel and the extensive collection of Gary D. Alpert located at the MCZC. Overall, this revision included the study of approximately 1,700 specimens of Anochetus and Odontomachus from 1014 recorded collecting events from throughout Madagascar with additional samples from Comoros and Seychelles. Roy Snelling (LACM) provided the records of O. simillimus from his work on the ants of Seychelles. Samples were selected for CO1 sequencing throughout the geographic range of each species. In total, 501 specimens were sequenced. Specimens examined from Madagascar are listed by increasing latitude within provinces. All species and type material examined in this study have been imaged and are available on AntWeb (www.antweb.org). Material was deposited at the California Academy of Sciences, San Francisco (CASC); British Museum of Natural History, London (BMNH); and Museum of Comparative Zoology, Harvard University, Cambridge, Massachusetts (MCZC). All sequences, oligonucleotides and electropherograms are deposited in BOLD (www.barcodinglife.org), and sequence data has been deposited on Genbank. In accordance with section 8.6 ofthe ICZN's International Code of Zoological Nomenclature, we have deposited copies ofthis article at the following five publicly accessible libraries: Natural History Museum, London, UK; American Museum of Natural History, New York, USA; Museum National d'Histoire Naturelle, Paris, France; Russian Academy of Sciences, Moscow, Russia; Academia Sinica, Taipei, Taiwan. The three new species names established herein have been prospectively registered in ZooBank [6-8], the official online registration system for the ICZN. The ZooBank publication LSID (Life Science Identifier) for the new species described herein can be viewed through any standard web browser by appending the LSID to the prefix "http://zoobank.org/". New specific names in this work are attributive genitive nouns and thus invariant. Each specimen discussed below is uniquely identified with a specimen-level code (e.g. CASENT0003099 ) affixed to each pin. In addition, each specimen may include a collection code, which is a field number that uniquely identifies collecting events (e.g. BLF01652). Collection codes, when available, are associated with a collector and follow the collector's name. Digital color images were created using a JVC KY-F75 digital camera and Syncroscopy Auto-Montage (v 5.0) software. All measurements were taken at 80 x power with a Leica MZ APO microscope using an orthogonal pair of micrometers, recorded to the nearest 0.001 mm, and rounded to two decimal places for presentation. When more than one specimen was measured, minimum and maximum measurements and indices are presented. Measurements follow those used by Brown [1,2]. Abdominal segments are noted by ''A'' and the segment number, such as A2 for the petiole and A3 for the first gastral segment. Abbreviations used: HL Head length: measured in full-face view; maximum longitudinal length from the anteriormost portion of the projecting mandible joint (the dorsal socket where the mandible turns) to the midpoint of a line across the posterior margin. (male: including ocelli) HW Head width: Anochetus : maximum width of head; Odontomachus : HW (across upper eye margin): maximum width ofhead measured across posterior margin of eyes; HW (across vertex): maximum width of head measured across temporal prominences. In O. coquereli , which lacks temporal prominences, the measurement is taken across the part of the vertex at which the sides are nearly parallel near or a little behind the midlength of the head. (male: including eyes) ML Mandible length: The straight-line length of the mandible at full closure, measured in the same plane for which the HL measurement is taken (full face view), from the mandibular apex to the anterior clypeal margin, or to the transverse line connecting the anterior most points in those taxa where the margin is concave medially. EL Eye length: maximum length of eye as measured normally in oblique view of the head to show full surface of eye. SL Scape length: maximum chord length excluding basal condyle and neck. WL Weber's length (Mesosoma length): in lateral view of the mesosoma, diagonal length from posteroveIntral corner of propodeum to the farthest point on anterior face of pronotum, excluding the neck. PW Pronotum width: in dorsal view, maximum width of pronotum. FL Femur length: Maximum length of hind femur. CI Cephalic index: HW/HL x 100. SI Scape index: SL/HWx 100. MI Mandible Index: ML/HLx 100 Specimens of Anochetus and Odontomachus were examined from the following collections: BMNH Natural History Museum, London, U. K. CASC California Academy of Sciences, San Francisco, CA, USA LACM Los Angles County Museum, Los Angeles, CA, USA MCZC Museum of Comparative Zoology, Harvard University, Cambridge, MA, USA MHNG Museum d'Histoire Naturelle, Geneva, Switzerland MNHN Museum National d'Histoire Naturelle, Paris, France MRAC Musee Royal de l'Afrique CeIntrale, Tervuren, Belgium MSNG Museo Civico de Historia Natural ''Giacomo Doria'', Genoa, Italy NHMB Naturhistorisches Museum, Basel, Switzerland PSWC P. S. Ward Collection, University of California at Davis, CA, USA CO1 methods Specimens were preserved in 95% ethanol in Madagascar and upon return to California were loaded into ScrewTop TrakMatesA ® boxes (Matrix Technologies) and shipped to the University of Guelph. There, DNA was extracted from tissues rich in mitochondria(e.g. legs), employing primers with high universality, and amplifying a PCR product approximately 600 bp in length. Total genomic DNA extracts were prepared from small pieces (# 1mm) of tissue using the NucleoSpinA ® 96 Tissue kit (Macherey-Nagel Duren, Germany), following the manufacturer's protocols. Extracts were resuspended in 30 µl of dH2O, and a 650base-pair (bp) region near the 5' terminus ofthe CO1 gene was amplified following standard protocol [9]. Briefly, full length sequences were amplified using primers (LF1-ATTCAACCAATCATAAAGATATTGG and LR1- TGATTTTTTGGACATCCAGAAGTTTA [10]). In cases where a 650 bp product was not successfully generated, internal primer pairs (LF1-ANTMR1-(see Table 1)) and (MLF1 - GCTTTCCC- ACGAATAAATAATA [11] - LR) were employed to generate shorter overlapping sequences that allowed the creation of a composite sequence (contig). PCR reactions were carried out in 96 well plates in 12.5 µl reaction volumes containing: 2.5 mM MgCl2, 5 pmol of each primer, 20 µl dNTPs, 10 mM Tris HCl (pH 8.3), 50 mM KCl, 10-20 ng (1-2 µl) of genomic DNA, and 1 unit of TaqDNA polymerase ( PlatinumA ® Taq DNA Polymerase - Invitrogen) using a thermocycling profile of one cycle of 2 min at 94°C, five cycles of 40 sec at 94°C, 40 sec at 45°C, and 1 min at 72°C, followed by 36 cycles of 40 sec at 94°C, 40 sec at 51°C, and 1 min at 72°C, with a final step of 5 min at 72°C. Products were visualized on a 2% agarose E-GelA ® 96-well system (Invitrogen) and samples containing clean single bands were bidirectionally sequenced using BigDye v3.1 on an ABI 3730xl DNA Analyzer (Applied Biosystems). Contigs were made using Sequencher v4.0.5 (Gene Codes) and were subsequently aligned by eye in Bioedit [12]. Sequence divergences were calculated using the K2P distance model [13] and a NJ tree of distances [14] was created to provide a graphic representation of the patterning among-species divergences using MEGA3 [15], and BOLD [16]. Sequence neutrality [Tajima's D - 17] and rates of substitution were calculated with DnaSP v.3 [18]. Sequences and other specimen information are available in the project file ''Revision of Malagasy Anochetus and Odontomachus'' in the Published Projects section of the Barcode of Life website (www.barcodinglife.org) with complete collection information for each specimen deposited at www.antweb.org. All sequences from the barcode region have been deposited in Genebank (CO1: EF610629 : EF611041 , EF999925 - EF999945 ). A composite representation of variation within the CO1 DNA barcode for each of the eight species revised here is presented in Figures 15 and 16. We used the online program Fingerprint [19 - http://evol.mcmaster.ca/fingerprint] to illustrate the heterogeneity at a specific site within the barcode region as a percentage of the vertical line drawn to represent each base pair. Diagnostic base pairs (or combination of base pairs) for each species within the Malagasy region are presented. This more cladistic interpretation of the DNA barcode data is very sensitive to the number of specimens analyzed - and the fewer specimens incorporated, the greater the likelihood that a rare haplotype is not reflected in the data. We present this method of analysis not to that our coverage of each species is sufficient to reflect the variation within a species, but rather to demonstrate that such an analysis is possible within a group of taxa or region, when there is good representation of the variability within a species. The nucleotide position given refers to the barcode region, and can be compared to their full mitochondrial position by adding 48 (as aligned to the Bos taurus complete mitochondrial genome sequence Genbank ref AY676873 ). The standard IUPAC ambiguity codes are used to denote iIntra-specific variation. Complementary genetic analyses. In addition to the CO1 barcode, for some specimens we amplified portions of the rRNA gene regions: 18S, 28S (D2) and ITS1. Within the variable D2 region of 28S, the forward primer corresponds to positions 3549- 3568 in Drosophila melanogaster reference sequence (Genbank M21017 ). Within the 18S sequence, the forward primer corresponds to positions 375-406 in Drosophila melanogaster reference sequence while the ITS1 sequence was generated using primers where the forward primer corresponds to positions 1822- doi:10.1371/journal.pone.0001787.t001 1843 in Drosophila melanogaster reference sequence. Representative sequences have been deposited in Genbank: 18S: EU041960 - EU042009 ; 28S: EU042010 - EU042038 , EU073708 : EU073711 ; ITS1: EU042039 - EU042097 , EU073664 : EU073707 ). Primers used to generate these fragments are listed in Table 1. In some cases we utilized a standard PCR diagnostic to test for Wolbachia [20]. Wolbachia are obligate iIntracellular endosymbiotic bacteria that cause reproductive incompatibility between infected and uninfected lineages, resulting in an increased proportion of infected maternal lineages that cannot reproduce. Results Taxonomic synopsis Check-List of Malagasy Anochetus Species boltonisp. nov. goodmanisp. nov. grandidieri Forel , 1891 = madecassus Santschi , 1928 madagascarensis Forel , 1887 = africanus var. friederichsi Forel , 1918 pattersonisp. nov. Key to workers and queens of Malagasy Anochetus 1. Inner mandibular blade without preapical teeth and denticles (Figs 3a, 4a) .................................. 2 Inner mandibular blade with at least four preapical teeth and denticles (Figs 2a,e)............................. 4 2. Worker compound eye large,>0.15 mm long. In full face view, antennal scape extends beyond posterior margins of occipital lobe. Dorsal surface of head and mesosoma with or without numerous short setae...................... 3 Worker compound eyes small, <0.15 mm long. In full face view, antennal scape usually fail to reach, and never surpass, posterior margin of occipital lobe. Dorsal surface of head with numerous short setae (Fig. 3a)............. grandidieri 3. Dorsal surface of head and mesosoma without numerous short setae (Fig. 3a). Pronotal dorsum glassy smooth. ............................. madagascarensis Dorsal surface of head and mesosoma with numerous short setae (Figs 7a,b). Pronotal dorsum with punctures anteriorly and longitudinal ridges posteriorly (Aldabra).... pattersoni 4. Petiolar node as seen from front or rear with apical margin deeply concave, lateral corner forming long spine (Fig. 5a)................................ boltoni Petiolar node as seen from front or rear with apical margin rounded, or slightly flattened, the lateral corner without spine (Fig. 5b).............................. goodmani Key to males of Malagasy Anochetus (males of goodmani unknown and not included) 1. Shortest distance between lateral ocellus and margin of compound eye smaller than maximum length of ocellus. Petiolar node as seen from front or rear with lateral corners rounded, without acute spine or sharp tooth ........... 2 Shortest distance between lateral ocellus and margin of compound eye distinctly greater than maximum length of ocellus. Petiolar node as seen from front or rear with lateral corners with acute spine or tooth ................... 3 2. Body yellowish brown. Petiolar node as seen from front or rear with apical margin concave. Paramere simple with rounded apex (Fig. 8c) .................... madagascarensis Body dark brown, black. Petiolar node as seen from front or rear with apical margin more or less flat. Paramere constricted apically into a veIntrally-directed digitiform lobe (Fig. 8d) ............................. pattersoni 3. Head and mesoscutum with dense reticulate sculpture, opaque, not smooth or shiny. Declivitous surface ofpropodeum abrupt, about as long as dorsal surface............. grandidieri Head and mesoscutum with week sculpture, smooth and shiny areas present. Declivitous surface of propodeum gradually sloping posteriorly, indistinctly delimited from dorsal surface................................. boltoni Anochetus boltoni Fishersp. nov.urn:lsid:zoobank.org:act:B6C072CF-1CA6-40C7-8396-534E91EF7FBB Figures: worker 2a,b, 5a; male 2c,d, 8a; map 6a Type Material: Holotype worker, Anochetus boltoni CASENT0104542 -14.43667 49.775 Madagascar Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa, 8.2 km 333° NNW Manantenina MADAGASCAR: Antsiranana, Parc National de Marojejy, Manantenina River, 28.0 km 38° NE -14.43667 49.775 Andapa , 8.2 km 333° NNW -14.43667 49.775 Manantenina , 14°26'12"S , 049°46'30"E , 450 m, sifted litter, rainforest, 12-15 -14.43667 49.775 Nov 2003 (coll. B. L. Fisher et al.), comma collection code: BLF08985 pin code: CASENT0104542 ( CASC ) . Anochetus boltoni CASENT0487895 -14.43667 49.775 Madagascar Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa, 8.2 km 333° NNW Manantenina Paratype . 8 workers with same data as holotype but pins coded, CASENT0487895 , Anochetus boltoni CASENT0487896 -14.43667 49.775 Madagascar Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa, 8.2 km 333° NNW Manantenina CASENT0487896 , Anochetus boltoni CASENT0487897 -14.43667 49.775 Madagascar Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa, 8.2 km 333° NNW Manantenina CASENT0487897 , Anochetus boltoni CASENT0006943 -14.43667 49.775 Madagascar Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa, 8.2 km 333° NNW Manantenina CASENT0006943 . ( BMNH , MCZ , CAS ) ; Anochetus boltoni CASENT0487895-D01 -14.43667 49.775 Madagascar Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa, 8.2 km 333° NNW Manantenina CO1 Barcode from paratype collection and coded CASENT0487895-D01 Worker measurements: maximum and minimum based on all specimens, n= 20, (holotype): HL 1.80-2.08 (1.95), HW 1.61- 1.89 (1.71), CI 87-98 (88), EL 0.33-0.41 (0.36), ML 1.15-1.25 (1.20), MI 59-66 (61), SL 1.83-1.96 (1.84) SI 101-115 (107), WL 2.63-2.89 (2.73), FL 1.97-2.13 (2.03), PW 0.95-1.06 (1.00). Male measurements: maximum and minimum based on n = 2 from Madagascar: HL 0.89-0.91, HW 1.05-1.13, CI 118- 125, EL 0.56-0.62, SL 0.24, SI 21-23, WL 2.20-2.24, FL 1.75-1.80 Worker Diagnosis: Blade of mandible with five teeth and denticles located along distal two thirds of blade's length. Propodeum with short teeth (Fig. 5a). Dorsolateral margin of petiole with long spine (Fig. 5a). In frontal view, petiolar margin deeply U-shaped. Pilosity, sculpture as in Figures 2a,b. Male caste: Dorsolateral margin of petiole with acute spine. The species is most similar to A. goodmani , but can be easily distinguished by its petiole node with a pair of large apical spines. Distribution and biology. The distribution is limited to collections made between 450 m and 750 m in rainforest in Parc National de Marojejy and 240 m from Ambanitaza near Antalaha (Fig. 4a). It has been collected three times in rotten logs and once in a leaf litter sample. Males have been collected in malaise samples on 20-25 Dec 2004 at 488 m in Parc National de Marojejy. CO1. The two populations where collections have been made to date are characterized by a deep divergence within the DNA barcode region (Maximum - 8%) (Fig. 15). Diagnostic barcoding loci. A. boltoni : ATCT-42-45 & RTTAR-66-70 Discussion: Specimens from Ambanitaza differ notably in shape of propodeal spines and length of spines on petiole from those of the type locality. Though these localities are quite close (40 km apart), these character differences are noticeable, and correspond to significant differences in CO1 (34 base pairs) and ITS1. While specimens from each location were invariant within 18S , there is a 7 bp insertion within ITS1 that is characteristic of the Ambanitaza population which is missing from all specimens from Marojejy. Ultimately, more collections need to be made and evaluated in order to test the hypothesis that these populations represent separate species. One important factor to consider in the testing of that hypothesis is reproductive strategy, which is, to our knowledge, through fission. Though the queen caste is not known, based on overall similarity of workers with A. goodmani , it is likely that the queen of boltoni is wingless. Queens have never been collected during the 12 month malaise trap sampling even though males were collected. Species that reproduce by fission may show greater geographic differences in morphology and CO1. Additional material examined for Anochetus boltoni : In addition to the type material, specimens from 4 additional collecting events from the following three localities were examined in this study. MADAGASCAR MADAGASCAR : Province Antsiranana : Parc National de Marojejy , Manantenina River, 27.6 km 35° NE Andapa ; Parc National de Marojejy , Manantenina River, 28.0 km 38° NE Andapa ; Anochetus boltoni CASENT0011443 -14.67933 50.18367 Madagascar Forêt Ambanitaza, 26.1 km 347° Antalaha -14.67933 50.18367 Foret Ambanitaza , 26.1 km 347° -14.67933 50.18367 Antalaha . This material shows greater variation in number of denticles along blade of mandible, ranging from 5-7, compared to the paratypic material. Anochetus goodmani Fishersp. nov.urn:lsid:zoobank.org:act:C7D27B95-E1F0-41AC-968C-76BCF3886010Figures: worker 2e,f; queen 2g,h; map 6a Type Material: Holotype worker, Anochetus goodmani CASENT0498309 -13.255 49.61667 Madagascar Forêt de Binara, 7.5 km 230° SW Daraina MADAGASCAR , Foret de Binara , 7.5 km 230° SW -13.255 49.61667 Daraina , 13°15'18"S , 049°37'00"E , 375 m, 1-4 -13.255 49.61667 Dec 2003 (coll. B. L. Fisher et al.), collection code: BLF09638, pin code: CASENT0498309 ( CAS ). Anochetus goodmani CASENT104548 -13.255 49.61667 Madagascar Forêt de Binara, 7.5 km 230° SW Daraina Paratypes : 8 workers with same data as holotype but pins coded, CASENT104548 , Anochetus goodmani CASENT0498310 -13.255 49.61667 Madagascar Forêt de Binara, 7.5 km 230° SW Daraina CASENT0498310 , Anochetus goodmani CASENT0498311 -13.255 49.61667 Madagascar Forêt de Binara, 7.5 km 230° SW Daraina CASENT0498311 , Anochetus goodmani CASENT0006944 -13.255 49.61667 Madagascar Forêt de Binara, 7.5 km 230° SW Daraina CASENT0006944 , Anochetus goodmani CASENT0006945 -13.255 49.61667 Madagascar Forêt de Binara, 7.5 km 230° SW Daraina CASENT0006945 ( BMNH , MCZ , CAS ) ; CO1 Barcode from paratype collection and coded CASENT0498310-D01 . Worker measurements: maximum and minimum based on all specimens, n= 15, (holotype): HL 1.77-2.01 (1.92), HW 1.55- 1.81 (1.77), CI 86-92 (92), EL 0.35-0.43 (0.42), ML 1.04-1.15 (1.11), MI 56-66 (58), SL 1.68-1.97 (1.79) SI 101-109 (101), WL 2.52-2.89 (2.66), FL 1.85-2.17 (2.03), PW 0.92-1.06 (1.01). Queen (ergatoid) measurements: maximum and minimum based on n = 5. HL 1.62-1.79, HW 1.49-1.65, CI 91-93, EL 0.37-0.41, ML 0.92-1.02, MI 55-59, SL 1.56-1.71, SI 99- 106, WL 2.33-2.55, FL 1.77-1.91, PW 0.88-0.99. Worker Diagnosis: Blade of mandible with five teeth and denticles located at the distal halfofthe blade length. Petiole dorsal margin without spines. In front view, the dorsal petiolar margin flat with lateral margin rounded (Fig. 6b). Pilosity, sculpture as in Figures 2e,f. The species is most similar to A. boltoni but can be easily distinguished by its petiole node without apical spines. No winged queens are known. Ergatoid queens were collected at six localities. In four of the collections, three ergatoid queens were collected in the same locality. They are very similar in size and shape to workers (Figs 2g,h), and have no ocelli (Fig. 2g). Males are not known. Distribution and biology. A. goodmani is endemic to Madagascar and is widespread in northern and western parts of the island. It has been collected in dry forest and rainforest as low as 30 m in altitude and also in montane rainforest at the altitude 960 m on Montagne d'Ambre (Fig. 6a), most frequently under stones (12 collections) and sifted litter (7), but also at light (1), beating low vegetation (3), rot pocket (1), in rotten log (6), ground foragers (1), ground nest (9), Malaise trap (1), on low vegetation (1), and pitfall traps (4). CO1. Average iIntraspecific sequence divergence of 6.37%. There is strong geographic coherence in the divergence patterns (Figs 9, 15, Table 2) with deep divergences occurring between separate regions isolated by habitat and mountains. Diagnostic barcoding loci. A. goodmani : Y-231 ( madagascarensis and grandidieri A; boltoni and pattersoni T), W-233 (all others A), RWR-368-370 (others are all ATG), Y-541 (others are all T), R-543 (others are all A), W-546 (others are all T), W-585 (others are all T), M-634 (others are all C). RWCW-42-45 & WTTAG-66-70 (this distinguishes goodmani from all (including boltoni ) except some madagascarensis ), & GT-83-84 ( madagascarensis is TA). Discussion. Anochetus goodmani is characterized by extreme divergence within the barcode region. To date, sequencing complementary nuclear markers has provided some degree of support for the deepest CO1 divergences (between the north and south-west of Madagascar) as being separate species. Importantly however, ITS1 sequences as divergent have been produced from the same individual (Appendix S1 and Table 3). Although CO1 supports more than one operational unit within A. goodmani the hypothesis of cryptic species in relatively isolated environments requires further evidence with less ambiguity. Additional material examined for Anochetus goodmani : In addition to the type material, specimens from 56 additional collecting events from the following 18 localities were examined in this study. MADAGASCAR MADAGASCAR : Province Antsiranana : Montagne des Francais , 7.2 km 142° SE Antsiranana ; MADAGASCAR Parc National Montagne d'Ambre ; Anochetus goodmani CASENT0416366 -12.86361 49.22583 Madagascar Réserve Spéciale de l'Ankarana, 13.6 km 192° SSW Anivorano Nord Reserve Speciale de l'Ankarana , 13.6 km 192° SSW -12.86361 49.22583 Anivorano Nord ; Anochetus goodmani CASENT0414220 -12.90889 49.10983 Madagascar Réserve Spéciale de l'Ankarana, 22.9 km 224° SW Anivorano Nord Reserve Speciale de l'Ankarana , 22.9 km 224° SW -12.90889 49.10983 Anivorano Nord ; Anochetus goodmani CASENT0498451 -12.97 49.7 Madagascar Forêt d'Ampondrabe, 26.3km 10° NNE Daraina -12.97 49.7 Foret d'Ampondrabe, 26.3 km 10° NNE -12.97 49.7 Daraina ; Anochetus goodmani CASENT0043718 -13.11833 49.23 Madagascar Forêt d' Andavakoera, 21.4km 75° ENE Ambilobe; 4.6km 356° N Betsiaka Foret d' Andavakoera , 21.4 km 75° ENE -13.11833 49.23 Ambilobe ; 4.6 km 356° N Betsiaka ; Anochetus goodmani CASENT0053785 -13.21167 49.55667 Madagascar Forêt d' Antsahabe, 11.4km 275° W Daraina Foret d' Antsahabe , 11.4 km 275° W -13.21167 49.55667 Daraina ; Anochetus goodmani CASENT0006944 -13.255 49.61667 Madagascar Forêt de Binara, 7.5 km 230° SW Daraina Foret de Binara , 7.5 km 230° SW -13.255 49.61667 Daraina ; Anochetus goodmani CASENT0416367 -13.79861 48.16167 Madagascar Ampasindava, Forêt d'Ambilanivy, 3.9 km 181° S Ambaliha Ampasindava, Foret d'Ambilanivy , 3.9 km 181° S -13.79861 48.16167 Ambaliha ; Anochetus goodmani CASENT0416370 -14.30889 47.91433 Madagascar Forêt d'Anabohazo, 21.6 km 247° WSW Maromandia Foret d'Anabohazo , 21.6 km 247° WSW -14.30889 47.91433 Maromandia ; Anochetus goodmani CASENT0022239 -16.925 44.36833 Madagascar Réserve Spéciale de Bemarivo, 23.8 km 223° SW Besalampy Reserve Speciale de Bemarivo , 23.8 km 223° SW -16.925 44.36833 Besalampy ; Anochetus goodmani CASENT0472827 -18.70944 44.71817 Madagascar Parc National Tsingy de Bemaraha, 10.6 km ESE 123° Antsalova Parc National Tsingy de Bemaraha , 10.6 km ESE 123° -18.70944 44.71817 Antsalova ; Anochetus goodmani CASENT0443749 -19.13222 44.81467 Madagascar Parc National Tsingy de Bemaraha, 2.5 km 62° ENE Bekopaka, Ankidrodroa River Parc National Tsingy de Bemaraha , 2.5 km 62 ° ENE -19.13222 44.81467 Bekopaka , -19.13222 44.81467 Ankidrodroa River ; Anochetus goodmani CASENT0078075 -19.14194 44.828 Madagascar Parc National Tsingy de Bemaraha, 3.4 km 93° E Bekopaka, Tombeau Vazimba Parc National Tsingy de Bemaraha , 3.4 km 93° E -19.14194 44.828 Bekopaka , -19.14194 44.828 Tombeau Vazimba . Anochetus goodmani CASENT0015320 -20.79528 44.147 Madagascar Parc National de Kirindy Mite, 16.3 km 127° SE Belo sur Mer Province Toliara : -20.79528 44.147 Parc National de Kirindy Mite , 16.3 km 127° SE -20.79528 44.147 Belo sur Mer . Anochetus grandidieri ForelFigures: worker 3a-d, 5c; queen 3e-h; male 3i-j, 8b; map 6b Type material: Anochetus grandidieri Forel , 1891: 108 [21]. Lectotype: worker, CASENT0101819 Madagascar Madagascar , Forest of the east coast ( M. Humblot ) ( MHNG ), present designation [examined], AntWeb CASENT0101819 . Brown, 1978: 606 [2] (description of worker) . Anochetus madecassus Santschi , 1928: 54 [22]. Lectotype: dealate queen, CASENT0101098 Madagascar Madagascar , Nossi-Be( Descarpentries ) ( NHMB ) Lectotype by present designation [examined] AntWeb CASENT0101098 . Synonymized with grandidieri by Brown, 1978: 557 [2]. Worker measurements: maximum and minimum based on all specimens, n = 20. HL 0.79-1.19, HW 0.71-1.06, CI 85-95, EL 0.08-0.13, ML 0.33-0.57, MI 41-54, SL 0.57-0.88, SI 78-86, WL 0.87-1.35, FL 0.57-0.90, PW 0.44-0.62. Queen measurements: maximum and minimum based on n = 5. HL 0.88-1.15, HW 0.81-1.07, CI 92-96, EL 0.17-0.23, ML 0.39-0.56, MI 44-49, SL 0.62-0.87, SI 77-81, WL 1.08- 1.46. FL 0.68-0.96, PW 0.60-0.78. Male measurements: maximum and minimum based on n = 5 from Madagascar: HL 0.58-0.73, HW 0.78-0.94, CI 129- 135, EL 0.37-0.46, SL 0.10-0.15, SI 13-16, WL 1.17-1.52, FL 0.78-1.08 Worker diagnosis: Inner blade of mandible without teeth and denticles; apical end of inner blade without a notched semicircular concavity (Fig. 2a). Eyes small (0.05-0.11 mm), projecting dorsolaterally. In full face view, antennal scape usually not reaching, and not surpassing posterior margin of occipital lobe. Dorsal surface of head with numerous short setae. Pilosity and sculpture as in Figures 3 a-d. Queens alate: Very similar to workers, only slightly larger than respective size class (Figs 3e-h). Ergatoid queens not recorded. Within a single locality, two size classes of workers, queens and males are present in this species, but the differences within a site do not hold up when variation across all sites is included. These differences suggest that two reproductive and developmental pathways can occur in this species. Further work is needed to explore the biotic or abiotic factors that trigger the development of small and large castes. The species is most similar to A. madagascarensis but can be easily distinguished by its small eyes and scape that does not surpass the occipital lobe. A. madagascarensis has large eyes (0.24-0.26 mm), and scapes that surpass occipital lobes. Distribution and biology. A. grandidieri is endemic to Madagascar and is widespread throughout Madagascar in forest and shrubland habitats below 1,550 m elevation (Fig 4b). It has been collected in gallery, dry, littoral, lowland, and montane forest, in desert spiny bush thicket in the southwest, and Uapaca woodland in the ceIntral plateau. As in many soil dwelling ants, A. grandidieri has reduced eyes (EL/HW 0.11-0.13) and short scapes. A. grandidieri is the only Anochetus in Madagascar with these soil nesting modifications. The subterranean habitat of this species may allow it to survive in a wide range of habitats in Madagascar from desert to woodland to montane forest. Out of 453 collecting events, A. grandidieri was most often recorded in sifted litter (97 collection records), rotten logs (96), and Malaise traps (155). CO1. Shallow iIntraspecific (average within species sequence divergence of 2.72, SE = 0.048) and deep interspecific divergences(9.4% SE = 0.05) between A. grandidieri and the other species. Small and large castes had identical DNA barcodes. (Figs 9, 16). Diagnostic barcoding loci. A grandidieri : T-273, T-282, T- 306, A-312, (shared with one population of A. goodmani ), A-312, T- 333, A-483, T-528 (all 3rd base pair positions). Specimens examined for Anochetus grandidieri : Specimens from 456 separate collection events from the following 140 localities were examined. MADAGASCAR MADAGASCAR : Province Antsiranana : Sakalava Beach ; MADAGASCAR Montagne des Francais , 7.2 km 142° SE Antsiranana ; Anochetus grandidieri CASENT0056906 -12.5283 49.1725 Madagascar Antsiranana II Pref: Antsahampano S.-Pref: Montagne d'Ambre. Site MD2 Antsiranana II Pref: Antsahampano S.-Pref : -12.5283 49.1725 Montagne d'Ambre. Site MD2 ; Anochetus grandidieri CASENT0416435 -12.53444 49.1795 Madagascar Parc National Montagne d'Ambre, 3.6 km 235° SW Joffreville Parc National Montagne d'Ambre , 3.6 km 235° SW -12.53444 49.1795 Joffreville ; Anochetus grandidieri CASENT0081746 -12.86361 49.22583 Madagascar Réserve Spéciale de l'Ankarana, 13.6 km 192° SSW Anivorano Nord Reserve Speciale de l'Ankarana , 13.6 km 192° SSW -12.86361 49.22583 Anivorano Nord ; Anochetus grandidieri CASENT0498462 -12.97 49.7 Madagascar Forêt d'Ampondrabe, 26.3km 10° NNE Daraina Foret d'Ampondrabe , 26.3 km 10° NNE -12.97 49.7 Daraina ; Anochetus grandidieri CASENT0041757 -13.21167 49.55667 Madagascar Forêt d' Antsahabe, 11.4km 275° W Daraina Foret d' Antsahabe , 11.4 km 275° W -13.21167 49.55667 Daraina ; Anochetus grandidieri CASENT0041177 -13.255 49.61667 Madagascar Forêt de Binara, 7.5 km 230° SW Daraina Foret de Binara , 7.5 km 230° SW -13.255 49.61667 Daraina ; Anochetus grandidieri CASENT0053760 -13.26333 49.60333 Madagascar Forêt de Binara, 9.1km 233° SW Daraina Foret de Binara , 9.1 km 233° SW -13.26333 49.60333 Daraina ; Anochetus grandidieri MCZ.3469w -13.41639 48.30722 Madagascar Nosy Be, Lokobe Forest -13.41639 48.30722 Nosy Be , -13.41639 48.30722 Lokobe Forest ; Anochetus grandidieri CASENT0054491 -13.4645 48.55167 Madagascar Forêt Ambato, 26.6 km 33° Ambanja Foret Ambato , 26.6 km 33° -13.4645 48.55167 Ambanja ; Anochetus grandidieri CASENT0054532 -13.71533 50.10167 Madagascar Ambondrobe, 41.1km 175° Vohemar Ambondrobe , 41.1 km 175° -13.71533 50.10167 Vohemar ; Anochetus grandidieri CASENT0416440 -13.79861 48.16167 Madagascar Ampasindava, Forêt d'Ambilanivy, 3.9 km 181° S Ambaliha Ampasindava, Foret d'Ambilanivy , 3.9 km 181° S -13.79861 48.16167 Ambaliha ; Anochetus grandidieri BLF1996(07)-4 -13.96167 48.43333 Madagascar R.S. Manongarivo, 10.8 km 229° SW Antanambao R.S. Manongarivo , 10.8 km 229° SW -13.96167 48.43333 Antanambao ; Anochetus grandidieri BLF1862(01)-3 -13.97667 48.42333 Madagascar R.S. Manongarivo, 12.8 km 228° SW Antanambao R.S. Manongarivo , 12.8 km 228° SW -13.97667 48.42333 Antanambao ; Anochetus grandidieri CASENT0006314 -13.99833 48.42833 Madagascar R.S. Manongarivo, 14.5 km 220° SW Antanambao R.S. Manongarivo , 14.5 km 220° SW -13.99833 48.42833 Antanambao ; Anochetus grandidieri CASENT0460194 -14.30889 47.91433 Madagascar Forêt d'Anabohazo, 21.6 km 247° WSW Maromandia Foret d'Anabohazo , 21.6 km 247° WSW -14.30889 47.91433 Maromandia ; Anochetus grandidieri CASENT0044502 -14.435 49.76 Madagascar Parc National de Marojejy, Manantenina River, 27.6 km 35° NE Andapa, 9.6 km 327° NNW Manantenina Parc National de Marojejy , Manantenina River , 27.6 km 35° NE -14.435 49.76 Andapa , 9.6 km 327° NNW -14.435 49.76 Manantenina ; Anochetus grandidieri CASENT0044925 -14.43667 49.775 Madagascar Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa, 8.2 km 333° NNW Manantenina Parc National de Marojejy, Manantenina River , 28.0 km 38° NE -14.43667 49.775 Andapa , 8.2 km 333° NNW -14.43667 49.775 Manantenina ; Anochetus grandidieri CASENT0062750 -14.43817 49.774 Madagascar Parc National Marojejy -14.43817 49.774 Parc National Marojejy ; Anochetus grandidieri MCZ122.13680w -14.44533 49.78564 Madagascar Marojejy R.N.I. #12 -14.44533 49.78564 Marojejy R.N.I. #12 ; Anochetus grandidieri CASENT0053288 -14.67933 50.18367 Madagascar Forêt Ambanitaza, 26.1 km 347° Antalaha Foret Ambanitaza , 26.1km 347° -14.67933 50.18367 Antalaha ; Anochetus grandidieri BLF1192(09)-2 -14.75 49.46667 Madagascar 9.2 km WSW Befingotra, Rés. Anjanaharibe-Sud 9.2 km WSW -14.75 49.46667 Befingotra , Res. Anjanaharibe-Sud ; Anochetus grandidieri BLF1070(05)-1 -14.75 49.5 Madagascar 6.5 km SSW Befingotra, Rés. Anjanaharibe-Sud 6.5 km SSW -14.75 49.5 Befingotra , Res. Anjanaharibe-Sud ; Anochetus grandidieri MCZ531.13121w -14.75775 49.51019 Madagascar 17km W Andapa, Res. d' Anjanaharibe-Sud 17 km W -14.75775 49.51019 Andapa , Res. d' Anjanaharibe-Sud ; Anochetus grandidieri MCZ280.7430w -14.93806 50.26167 Madagascar 5 km SW Antalaha 5 km SW -14.93806 50.26167 Antalaha ; Anochetus grandidieri MCZ609.10668w -15.29128 50.33803 Madagascar 14km W Cap Est, Ambato 14 km W Cap Est , -15.29128 50.33803 Ambato ; Anochetus grandidieri MCZ155.7552w -15.69694 50.27028 Madagascar Fotodriana, Cap Masoala Fotodriana , -15.69694 50.27028 Cap Masoala . Anochetus grandidieri CASENT0021098 -16.05167 45.90833 Madagascar Mahavavy River, 6.2 km 145° SE Mitsinjo Province Mahajanga : -16.05167 45.90833 Mahavavy River , 6.2 km 145° SE -16.05167 45.90833 Mitsinjo ; Anochetus grandidieri CASENT0464979 -16.26722 47.04861 Madagascar Réserve d'Ankoririka, 10.6 km 13° NE de Tsaramandroso Reserve d'Ankoririka , 10.6 km 13° NE de -16.26722 47.04861 Tsaramandroso ; Anochetus grandidieri CASENT0065458 -16.31944 46.81333 Madagascar Ampijoroa National Park, 160 km N Maevatanana Ampijoroa National Park , 160 km N -16.31944 46.81333 Maevatanana , -16.31944 46.81333 Mahajanga Prov ., deciduous forest ; Anochetus grandidieri CASENT0022147 -16.37667 45.32667 Madagascar Parc National de Namoroka, 17.8 km 329° WNW Vilanandro Parc National de Namoroka , 17.8 km 329° WNW -16.37667 45.32667 Vilanandro ; Anochetus grandidieri CASENT0034699 -16.40667 45.31 Madagascar Parc National de Namoroka, 16.9 km 317° NW Vilanandro Parc National de Namoroka , 16.9 km 317° NW -16.40667 45.31 Vilanandro ; Anochetus grandidieri CASENT0032649 -16.46667 45.35 Madagascar Parc National de Namoroka, 9.8 km 300° WNW Vilanandro Parc National de Namoroka , 9.8 km 300° WNW -16.46667 45.35 Vilanandro ; Anochetus grandidieri CASENT0022238 -16.925 44.36833 Madagascar Réserve Spéciale de Bemarivo, 23.8 km 223° SW Besalampy Reserve Speciale de Bemarivo , 23.8 km 223° SW -16.925 44.36833 Besalampy ; Anochetus grandidieri CASENT0079906 -18.70944 44.71817 Madagascar Parc National Tsingy de Bemaraha, 10.6 km ESE 123° Antsalova Parc National Tsingy de Bemaraha , 10.6 km ESE 123° -18.70944 44.71817 Antsalova ; Anochetus grandidieri CASENT0442086 -19.02139 44.44067 Madagascar Forêt de Tsimembo, 8.7 km 336° NNW Soatana Foret de Tsimembo , 8.7 km 336° NNW -19.02139 44.44067 Soatana ; Anochetus grandidieri CASENT0079905 -19.13222 44.81467 Madagascar Parc National Tsingy de Bemaraha, 2.5 km 62° ENE Bekopaka, Ankidrodroa River Parc National Tsingy de Bemaraha , 2.5 km 62° ENE -19.13222 44.81467 Bekopaka , -19.13222 44.81467 Ankidrodroa River ; Anochetus grandidieri CASENT0078074 -19.14194 44.828 Madagascar Parc National Tsingy de Bemaraha, 3.4 km 93° E Bekopaka, Tombeau Vazimba Parc National Tsingy de Bemaraha , 3.4 km 93° E -19.14194 44.828 Bekopaka , -19.14194 44.828 Tombeau Vazimba ; Anochetus grandidieri CASENT0050013 -15.17833 49.635 Madagascar Montagne d'Anjanaharibe, 19.5 km 27° NNE Ambinanitelo Province Toamasina : Montagne d'Anjanaharibe , 19.5 km 27° NNE -15.17833 49.635 Ambinanitelo ; Anochetus grandidieri CASENT0033450 -15.18833 49.615 Madagascar Montagne d'Anjanaharibe, 18.0 km 21° NNE Ambinanitelo Montagne d'Anjanaharibe , 18.0 km 21 ° NNE -15.18833 49.615 Ambinanitelo ; Anochetus grandidieri CASENT0034581 -15.28833 49.54833 Madagascar Montagne d'Akirindro 7.6 km 341° NNW Ambinanitelo Montagne d'Akirindro 7.6 km 341 ° NNW -15.28833 49.54833 Ambinanitelo ; Anochetus grandidieri MCZ10379-1.3470w -15.48333 49.9 Madagascar 19km ESE Maroantsetra 19 km ESE -15.48333 49.9 Maroantsetra ; Anochetus grandidieri BLF0976(50)-2 -15.56667 50 Madagascar 6.9 km NE Ambanizana, Ambohitsitondroina 6.9 km NE Ambanizana , -15.56667 50 Ambohitsitondroina ; Anochetus grandidieri CASENT0006895 -15.57167 50.00611 Madagascar Ambanizana, Parc National Masoala Ambanizana , -15.57167 50.00611 Parc National Masoala ; Anochetus grandidieri BLF0926(03)-3 -15.66667 49.96667 Madagascar 5.3 km SSE Ambanizana, Andranobe 5.3 km SSE Ambanizana , -15.66667 49.96667 Andranobe ; Anochetus grandidieri BLF0886(02)-2 -15.68333 49.95 Madagascar 6.3 km S Ambanizana, Andranobe 6.3 km S Ambanizana , -15.68333 49.95 Andranobe ; Anochetus grandidieri MCZ238.9884w -15.69361 50.18139 Madagascar 1km W Andampibe, Cap Masoala 1 km W -15.69361 50.18139 Andampibe , Cap Masoala ; Anochetus grandidieri CASENT0066831 -16.455 49.7875 Madagascar Parc National Mananara-Nord, 7.1 km 261° Antanambe Parc National Mananara-Nord , 7.1 km 261° -16.455 49.7875 Antanambe ; MADAGASCAR Foret d'Analava Mandrisy , 5.9 km 195° Antanambe ; MADAGASCAR Res. Ambodiriana , 4.8 km 306° Manompana , along Manompana River ; Anochetus grandidieri CASENT0068936 -16.82433 49.96417 Madagascar Ile Sainte Marie, Forêt Ambohidena, 22.8 km 44° Ambodifotatra Ile Sainte Marie , -16.82433 49.96417 Foret Ambohidena , 22.8 km 44° -16.82433 49.96417 Ambodifotatra ; Anochetus grandidieri CASENT0068356 -16.9225 49.88733 Madagascar Ile Sainte Marie, Forêt Kalalao, 9.9 km 34° Ambodifotatra Ile Sainte Marie , -16.9225 49.88733 Foret Kalalao , 9.9 km 34° -16.9225 49.88733 Ambodifotatra ; Anochetus grandidieri CASENT0047267 -17.28333 49.43333 Madagascar Parcelle E3 Tampolo Parcelle E3 -17.28333 49.43333 Tampolo ; Anochetus grandidieri CASENT0006646 -17.28333 49.41667 Madagascar S.F. Tampolo, 10 km NNE Fenoarivo Atn. S.F. Tampolo, 10 km NNE -17.28333 49.41667 Fenoarivo Atn . ; Anochetus grandidieri CASENT0096038 -17.65 49.46667 Madagascar Bridge at Onibi, NW of Mahavelona Bridge at Onibi , NW of -17.65 49.46667 Mahavelona ; Anochetus grandidieri CASENT0095526 -17.66667 49.5 Madagascar Mahavelona (Foulpointe) Mahavelona ( -17.66667 49.5 Foulpointe ) ; Anochetus grandidieri CASENT0067008 -17.67017 49.49583 Madagascar 2.1 km 315° Mahavelona 2.1 km 315° -17.67017 49.49583 Mahavelona ; Anochetus grandidieri CASENT0006670 -17.68333 49.51667 Madagascar Foulpointe -17.68333 49.51667 Foulpointe ; Anochetus grandidieri CASENT0066998 -17.88667 49.2025 Madagascar Reserve Betampona, Camp Vohitsivalana, 37.1 km 338° Toamasina Reserve Betampona , -17.88667 49.2025 Camp Vohitsivalana , 37.1 km 338° -17.88667 49.2025 Toamasina ; Anochetus grandidieri CASENT0066852 -17.924 49.19967 Madagascar Reserve Betampona, Camp Rendrirendry 34.1 km 332° Toamasina Reserve Betampona , -17.924 49.19967 Camp Rendrirendry 34.1 km 332° -17.924 49.19967 Toamasina ; Anochetus grandidieri HJR101(05)-6 -18.04833 49.09167 Madagascar F.C. Sandranantitra F.C. Sandranantitra ; Anochetus grandidieri CASENT0007159 -18.19833 48.57833 Madagascar F.C. Didy F.C. Didy ; Anochetus grandidieri HJR121(02)-6 -18.695 48.81333 Madagascar F.C. Andriantantely F.C. Andriantantely ; Anochetus grandidieri HJR111(01)-6 -18.79167 48.42667 Madagascar P.N. Mantadia P.N. Mantadia ; Anochetus grandidieri CASENT0050510 -18.80623 48.33707 Madagascar Analamay Analamay ; Anochetus grandidieri CASENT0052862 -18.85083 48.32 Madagascar Forêt Ambatovy, 14.3 km 57° Moramanga Foret Ambatovy , 14.3 km 57° -18.85083 48.32 Moramanga ; Anochetus grandidieri CASENT0006781 -18.87082 48.34737 Madagascar Torotorofotsy Torotorofotsy ; MADAGASCAR Andasibe National Park , botanic garden near eIntrance, West of ANGAP office ; Anochetus grandidieri CASENT0070215 -18.92778 48.41833 Madagascar Res. Analamazaotra, Parc National, Andasibe Res. Analamazaotra , Parc National , -18.92778 48.41833 Andasibe ; Anochetus grandidieri CASENT0049858 -20.59333 46.56333 Madagascar Forêt d'Atsirakambiaty, 7.6 km 285° WNW Itremo Fianarantsoa : -20.59333 46.56333 Foret d'Atsirakambiaty, 7.6 km 285° WNW -20.59333 46.56333 Itremo ; Anochetus grandidieri MCZ0.27w -21 47 Madagascar Ranomafana Nat. Park, Miaranony Forest Ranomafana Nat. Park , -21 47 Miaranony Forest ; Anochetus grandidieri CASENT0052053 -21.22617 47.36983 Madagascar Vohiparara broken bridge, Fianarantsoa Prov. Vohiparara broken bridge , -21.22617 47.36983 Fianarantsoa Prov . ; Anochetus grandidieri CASENT0492862 -21.23667 47.39667 Madagascar Parc National de Ranomafana, Sahamalaotra River, 6.6 km 310° NW Ranomafana Parc National de Ranomafana , -21.23667 47.39667 Sahamalaotra River , 6.6 km 310° NW -21.23667 47.39667 Ranomafana ; Anochetus grandidieri CASENT0096622 -21.24833 47.42667 Madagascar Parc Nationale Ranomafana: Talatakely Parc Nationale Ranomafana : -21.24833 47.42667 Talatakely ; Anochetus grandidieri MCZ10413-1.3462w -21.25 47.41667 Madagascar 3 km W Ranomafana, nr. Ifandiana 3 km W Ranomafana , nr. -21.25 47.41667 Ifandiana ; Anochetus grandidieri CASENT0170201 -21.25041 47.41945 Madagascar research cabin at Talatakely, Ranomafana National Park research cabin at -21.25041 47.41945 Talatakely , Ranomafana National Park ; Anochetus grandidieri CASENT0008842 -21.25083 47.40717 Madagascar radio tower, Ranomafana National Park, Fianarantsoa Prov. radio tower, Ranomafana National Park , -21.25083 47.40717 Fianarantsoa Prov .; Anochetus grandidieri CASENT0170202 -21.25833 47.42178 Madagascar Namorona River at footbridge, Ranomafana National Park -21.25833 47.42178 Namorona River at footbridge, Ranomafana National Park ; Anochetus grandidieri MCZ1.19931w -21.26583 47.425 Madagascar Ranomafana National Park, Tavolo tree Ranomafana National Park , Tavolo tree ; Anochetus grandidieri CASENT0057011 -21.2665 47.42017 Madagascar Belle Vue trail, Ranomafana National Park, Fianarantsoa Prov. Belle Vue trail , -21.2665 47.42017 Ranomafana National Park , -21.2665 47.42017 Fianarantsoa Prov . ; Anochetus grandidieri MCZ.8733w -21.26667 47.41667 Madagascar 7 km W Ranomafana 7 km W -21.26667 47.41667 Ranomafana ; Anochetus grandidieri CASENT0052976 -21.28955 47.4304 Madagascar Vatoharanana Vatoharanana ; Anochetus grandidieri CASENT0034842 -21.29 47.43333 Madagascar Parc National de Ranomafana, Vatoharanana River, 4.1 km 231° SW Ranomafana Parc National deRanomafana , -21.29 47.43333 Vatoharanana River , 4.1 km 231 ° SW -21.29 47.43333 Ranomafana ; Anochetus grandidieri CASENT0007734 -21.29073 47.42615 Madagascar P.N. Ranomafana, Vatoharanana-Ankovoka P.N. Ranomafana , -21.29073 47.42615 Vatoharanana-Ankovoka ; Anochetus grandidieri MCZ293.3192w -21.39306 47.94194 Madagascar 8km E Kianjavato, Vatovavy Forest 8 km E Kianjavato , -21.39306 47.94194 Vatovavy Forest ; MADAGASCAR 7.6 km 122° Kianjavato , Foret Classee Vatovavy ; Anochetus grandidieri CASENT0060864 -21.51167 47.41 Madagascar 2km W Andrambovato, along river Tatamaly 2 km W -21.51167 47.41 Andrambovato , along river -21.51167 47.41 Tatamaly ; Anochetus grandidieri CASENT0009492 -21.8275 47.33889 Madagascar Forêt d'Ambalagoavy Nord, Ikongo, Ambatombe Foret d'Ambalagoavy Nord , -21.8275 47.33889 Ikongo , -21.8275 47.33889 Ambatombe ; Anochetus grandidieri BLF0696(27)-1 -22.21667 47.01667 Madagascar 45km S. Ambalavao 45 km S. -22.21667 47.01667 Ambalavao ; Anochetus grandidieri CASENT0006645 -22.21667 47.01667 Madagascar 45 km S Ambalavao 45 km S -22.21667 47.01667 Ambalavao ; Anochetus grandidieri CASENT0006644 -22.23333 47 Madagascar 43 km S Ambalavao, Rés. Andringitra 43 km S -22.23333 47 Ambalavao , Res. Andringitra ; Anochetus grandidieri CASENT0491179 -22.29833 45.35167 Madagascar Parc National d'Isalo, Ambovo Springs, 29.3 km 4° N Ranohira Parc National d'Isalo , -22.29833 45.35167 Ambovo Springs , 29.3 km 4° N -22.29833 45.35167 Ranohira ; Anochetus grandidieri BLF1753(17)-10 -22.42167 46.89833 Madagascar 8.0 km NE Ivohibe 8.0 km NE Ivohibe ; Anochetus grandidieri BLF1757(02)-8 -22.42667 46.93833 Madagascar 9.0 km NE Ivohibe 9.0 km NE Ivohibe ; Anochetus grandidieri BLF1745(01)-8 -22.47 46.96 Madagascar R.S. Ivohibe, 7.5 km ENE Ivohibe R.S. Ivohibe , 7.5 km ENE -22.47 46.96 Ivohibe ; Anochetus grandidieri CASENT0034772 -22.48167 45.46167 Madagascar Parc National d'Isalo, 9.1 km 354° N Ranohira Parc National d'Isalo , 9.1 km 354° N -22.48167 45.46167 Ranohira ; Anochetus grandidieri CASENT0030566 -22.59167 45.12833 Madagascar Forêt d'Analalava, 29.6 km 280° W Ranohira Foret d'Analalava , 29.6 km 280° W -22.59167 45.12833 Ranohira ; Anochetus grandidieri CASENT0067265 -22.791 47.18183 Madagascar Forêt de Vevembe, 66.6 km 293° Farafangana Foret de Vevembe , 66.6 km 293° -22.791 47.18183 Farafangana ; MADAGASCAR Province Toliara : Anochetus grandidieri CASENT0028726 -18.26 45.41833 Madagascar Réserve Spéciale d'Ambohijanahary, Forêt d'Ankazotsihitafototra, 34.6 km 314° NW Ambaravaranala Reserve Speciale d'Ambohijanahary , -18.26 45.41833 Foret d'Ankazotsihitafototra , 34.6 km 314° NW -18.26 45.41833 Ambaravaranala ; Anochetus grandidieri CASENT0027540 -18.26667 45.40667 Madagascar Réserve Spéciale d'Ambohijanahary, Forêt d'Ankazotsihitafototra, 35.2 km 312° NW Ambaravaranala Reserve Speciale d'Ambohijanahary , -18.26667 45.40667 Foret d'Ankazotsihitafototra , 35.2 km 312° NW -18.26667 45.40667 Ambaravaranala ; Anochetus grandidieri BLF1310(36)-1 -22.46667 44.85 Madagascar Vohibasia Forest, 59 km NE Sakaraha Vohibasia Forest , 59 km NE -22.46667 44.85 Sakaraha ; Anochetus grandidieri BLF1312(11)-1 -22.46667 44.85 Madagascar southern Isoky-Vohimena Forest, 59 km NE Sakaraha southern Isoky-Vohimena Forest , 59 km NE -22.46667 44.85 Sakaraha ; Anochetus grandidieri CASENT0024504 -22.64333 44.17167 Madagascar Forêt Classée d'Analavelona, 33.2 km 344° NNW Mahaboboka Foret Classee d'Analavelona , 33.2 km 344° NNW -22.64333 44.17167 Mahaboboka ; Anochetus grandidieri CASENT0032641 -22.675 44.19 Madagascar Forêt Classée d'Analavelona, 29.2 km 343° NNW Mahaboboka Foret Classee d'Analavelona , 29.2 km 343° NNW -22.675 44.19 Mahaboboka ; Anochetus grandidieri CASENT0023082 -22.675 44.18667 Madagascar Forêt Classée d'Analavelona, 29.4 km 343° NNW Mahaboboka Foret Classee d'Analavelona , 29.4 km 343° NNW -22.675 44.18667 Mahaboboka ; Anochetus grandidieri CASENT0002347 -22.80222 43.42067 Madagascar Forêt de Tsinjoriaky, 6.2 km 84° E Tsifota Foret de Tsinjoriaky , 6.2 km 84° E -22.80222 43.42067 Tsifota ; Anochetus grandidieri CASENT0032632 -22.84333 44.71 Madagascar Parc National de Zombitse, 19.8 km 84° E Sakaraha -22.84333 44.71 Parc National de Zombitse , 19.8 km 84° E Sakaraha ; Anochetus grandidieri CASENT0493500 -22.88833 44.70167 Madagascar Parc National de Zombitse, 17.7 km 98° E Sakaraha Parc National de Zombitse , 17.7 km 98° E -22.88833 44.70167 Sakaraha ; Anochetus grandidieri MCZ11935-2.4314w -22.9 44.68333 Madagascar 15 km E Sakaraha 15 km E -22.9 44.68333 Sakaraha ; Anochetus grandidieri CASENT0449519 -23.52417 44.12133 Madagascar Forêt de Mite, 20.7 km 29° WNW Tongobory Foret de Mite , 20.7 km 29° WNW -23.52417 44.12133 Tongobory ; Anochetus grandidieri BLF1476(03)-1 -23.65 44.63333 Madagascar Beza-Mahafaly, 27 km E Betioky Sept Lacs; Beza-Mahafaly, 27 km E -23.65 44.63333 Betioky ; Anochetus grandidieri CASENT0007169 -23.68333 44.63333 Madagascar Ehazoara Canyon, 26 km E Betioky Ehazoara Canyon , 26 km E -23.68333 44.63333 Betioky ; Anochetus grandidieri CASENT0006634 -24.43806 47.21944 Madagascar 70.7 km NNE Tolanaro, Mahermano Mt. 70.7 km NNE Tolanaro , -24.43806 47.21944 Mahermano Mt .; Anochetus grandidieri BLF0492(17)-2 -24.56667 46.83333 Madagascar 11 km NW Enakara, Rés. Andohahela 11 km NW -24.56667 46.83333 Enakara , Res. Andohahela ; Anochetus grandidieri BLF0522(05)-1 -24.56667 46.81667 Madagascar 10 km NW Enakara, Rés. Andohahela 10 km NW Enakara , -24.56667 46.81667 Res. Andohahela ; Anochetus grandidieri MCZ11820-4.4105w -24.73333 46.8 Madagascar Rés. Andohahela, 6 km SSW Eminiminy -24.73333 46.8 Res . Andohahela , 6 km SSW -24.73333 46.8 Eminiminy ; Anochetus grandidieri CASENT0003866 -24.76389 46.75167 Madagascar Parc National d'Andohahela, Col du Sedro, 3.8 km 113° ESE Mahamavo, 37.6 km 341° NNW Tolagnaro Parc National d'Andohahela , -24.76389 46.75167 Col du Sedro , 3.8 km 113° ESE -24.76389 46.75167 Mahamavo , 37.6 km 341° NNW -24.76389 46.75167 Tolagnaro ; Anochetus grandidieri CASENT0003887 -24.76389 46.76683 Madagascar Parc National d'Andohahela, Manampanihy River, 5.4 km 113° ESE Mahamavo, 36.7 km 343° NNW Tolagnaro Parc National d'Andohahela , -24.76389 46.76683 Manampanihy River , 5.4 km 113° ESE -24.76389 46.76683 Mahamavo , 36.7 km 343° NNW -24.76389 46.76683 Tolagnaro ; Anochetus grandidieri BLF2102(02)-3 -24.77167 47.17167 Madagascar 2.7 km WNW 302° Ste. Luce 2.7 km WNW 302° -24.77167 47.17167 Ste. Luce ; MADAGASCAR 9.2 km N Tolanaro , Ilapany Mt . ; Anochetus grandidieri CASENT0006635 -24.93694 46.75361 Madagascar 29.5 km WNW Tolanaro, Vasiha Mt. 29.5 km WNW -24.93694 46.75361 Tolanaro , -24.93694 46.75361 Vasiha Mt . ; Anochetus grandidieri CASENT0079349 -24.93 46.6455 Madagascar Parc National d'Andohahela, Forêt d'Ambohibory, 1.7 km 61° ENE Tsimelahy, 36.1 km 308° NW Tolagnaro Parc National d'Andohahela , -24.93 46.6455 Foret d'Ambohibory , 1.7 km 61° ENE -24.93 46.6455 Tsimelahy , 36.1 km 308° NW -24.93 46.6455 Tolagnaro ; Anochetus grandidieri BLF2040(03)-11 -24.95167 47.00167 Madagascar Mandena, 8.4 km NNE 30° Tolagnaro Mandena , 8.4 km NNE 30° -24.95167 47.00167 Tolagnaro ; Anochetus grandidieri CASENT0003910 -24.95694 46.2715 Madagascar Réserve Privé Berenty, Forêt de Bealoka, Mandraré River, 14.6 km 329° NNW Amboasary Reserve Prive Berenty , -24.95694 46.2715 Foret de Bealoka , -24.95694 46.2715 Mandrare River , 14.6 km 329° NNW -24.95694 46.2715 Amboasary ; Anochetus grandidieri CASENT0003940 -25.00778 46.306 Madagascar Réserve Privé Berenty, Forêt de Malaza, Mandraré River, 8.6 km 314° NW Amboasary Reserve Prive Berenty , -25.00778 46.306 Foret de Malaza , -25.00778 46.306 Mandrare River , 8.6 km 314° NW -25.00778 46.306 Amboasary ; Anochetus grandidieri MCZ11862-2.4135w -25.01667 46.3 Madagascar Réserve Berenty Reserve Berenty; Anochetus grandidieri BLF2072(01)-1 -25.06167 46.87 Madagascar Forêt de Petriky, 12.5 km W 272° Tolagnaro -25.06167 46.87 Foret de Petriky , 12.5 km W 272° -25.06167 46.87 Tolagnaro ; Anochetus grandidieri CASENT0451236 -25.45056 44.97417 Madagascar 4.4 km 148° SSE Lavanono 4.4 km 148° SSE -25.45056 44.97417 Lavanono ; Anochetus grandidieri CASENT0003968 -25.59444 45.14683 Madagascar Réserve Spéciale de Cap Sainte Marie, 14.9 km 261° W Marovato Reserve Speciale de Cap Sainte Marie , 14.9 km 261° W -25.59444 45.14683 Marovato ; Anochetus grandidieri CASENT0062455 -22.8405 44.73117 Madagascar near road, Zombitse National Park, Tulear Prov. near road, -22.8405 44.73117 Zombitse National Park , Tulear Prov .; Anochetus grandidieri CASENT0063247 -22.8865 44.69217 Madagascar near ANGAP office, Zombitse National Park, Tulear Prov. near ANGAP office, ZombitseNational Park , -22.8865 44.69217 Tulear Prov .; Anochetus grandidieri CASENT0065596 -23.6865 44.591 Madagascar Parcel I, Beza Mahafaly Reserve, near research station, Tulear Province Parcel I, Beza Mahafaly Reserve , near research station, -23.6865 44.591 Tulear Province ; Anochetus grandidieri CASENT0061723 -24.93683 46.62667 Madagascar Tsimelahy - Parcel II, Andohahela National Park, transition forest, Tulear Province Tsimelahy - Parcel II , -24.93683 46.62667 Andohahela National Park , transition forest, -24.93683 46.62667 Tulear Province . Anochetus madagascarensis ForelFigures: worker 1a, 4a,b, 5d; queen 4c,d; male 4e,f, 8b; map 6c Type material: Anochetus africanus madagascarensis Forel , 1887: 382 [23]. Lectotype: worker, CASENT0101574 Madagascar Madagascar , Tamatave Province , Ivondro , ( Dr. Conrad Keller ) ( MHNG ) present designation [examined] AntWeb CASENT0101574 . Raised to species by Brown, 1978: 557 [2]. Anochetus africanus friederichsi Forel 1918: 155 [24]. Lectotype: worker, CASENT010165 Madagascar Madagascar , Tamatave Province , Prune Island ( Nosy Alanana ) ( Friederichs ) ( MHNG ), present designation [examined] AntWeb CASENT010165 . Synonymized with madagascarensis by Brown, 1978: 557 [2]. Worker measurements: maximum and minimum based on n = 20. HL 1.35-1.68, HW 1.19-1.53, CI 87-94, EL 0.23-0.28, ML 0.73-0.93, MI 53-57, SL 1.11-1.41, SI 89-95, WL 1.60- 2.02, FL 1.13-1.54, PW 0.63-0.80. Queen measurements: maximum and minimum based on n = 5. HL 1.52-1.66, HW 1.48-1.55, CI 92-97, EL 0.32-0.36, ML 0.81-0.89, MI 53-55, SL 1.26-1.39, SI 85-91, WL 1.99- 2.22. FL 1.35-1.49, PW 0.84-0.92. Male measurements: maximum and minimum based on n = 5 from Madagascar: HL 0.85-1.89, HW 1.07-1.20, CI 122- 135, EL 0.63-0.69, SL 0.20-0.22, SI 18-21, WL 1.90-1.98, FL 1.35-1.47 Worker Diagnosis: Inner blade of mandible without teeth and denticles; apical end of inner blade with notched semicircular concavity (Fig. 1a). Eyes large (0.24-0.26 mm), projecting dorsally. In full face view, antennal scape extends beyond posterior margin of occipital lobe. Dorsal surface of head asetose. Pilosity and sculpture as in Figures 4a,b. Queens alate: Very similar to worker and only slightly larger (Figs 4c,d). Queens of only one size. Ergatoid queens not recorded. Males: Males light yellowish brown in color and with large projecting ocelli on vertex (Figs 4e,f). Males have been collected in Malaise traps in every month of the year and males have been noted to swarm and fly at dusk and early evening. The species is most similar to A. grandidieri but can be easily distinguished by its large eyes (0.24-0.26 mm), and scapes that surpass occipital lobes. Distribution and biology. A. madagascarensis is widespread throughout Madagascar in forest or shrubland habitats below 1100 m elevation and is also known from the Comoros. Forel's (1912:159) record of a male ' Anochetus sp.? africanus var. madagascariensis Forel'' from Seychelles, Mahe, has not been seen and confirmed. This record most likely refers to pattersoni .In Madagascar, madagascarensis is widespread and has been collected in gallery, dry, littoral, lowland, and montane forests, and in desert spiny bush thicket in the southwest of Madagascar. The longer scapes and larger eyes of A. madagascarensis compared to A. grandidieri , correlate with nesting and foraging above the soil layer. The species was most often recorded nesting in rotten logs (99 collection records) followed by sifted litter (41). In addition, it was collected from dead twigs above ground (1), rot pockets (2), ground foragers (20), ground nests (6), Malaise trap (14), on low vegetation (2), and pitfall traps (4). CO1. Shallow iIntraspecific and deep interspecific divergences between A. madagascarensis and the other species. Average within species sequence divergence of 1.67% (SE = 0.055) (Fig. 16). Diagnostic barcoding loci. A. madagascarensis : A-21, T-423 (shared with one A. goodmani population), T-132 (shared with one A. grandidieri population), T-83, A-84, T-93, T, 138, C-306, T-513, A-595 Specimens examined for Anochetus madagascarensis : Specimens from 326 separate collection events from the following 129 localities were examined. Anochetus madagascarensis CASENT0100252 0 0 Mayotte Majimbini COMORES : Mayotte Island : 0 0 Majimbini ; Anochetus madagascarensis CASENT0100233 0 0 Mayotte Coconi DAF campus Coconi DAF campus ; Anochetus madagascarensis CASENT0100253 0 0 Mayotte Poroani Poroani ; Anochetus madagascarensis CASENT0100255 0 0 Mayotte Riv. Kouale nr. Caserne Riv. Kouale nr. Caserne ; Anochetus madagascarensis CASENT0009106 -12.76667 45.18333 Mayotte Convalescence Convalescence ; Anochetus madagascarensis CASENT0009062 -12.78333 45.11667 Mayotte Dziani Karihani DzianiKarihani ; Anochetus madagascarensis CASENT0011507 -12.78333 45.1 Mayotte Tsingoni Tsingoni ; Anochetus madagascarensis CASENT0011508 -12.8 45.1 Mayotte Mt. Choungui Mt. Choungui ; Anochetus madagascarensis CASENT0009055 -12.8 45.13333 Mayotte Mt. Combani Mt. Combani ; Anochetus madagascarensis CASENT0009060 -12.83333 45.13333 Mayotte Coconi, SDA (service du develppement agricole) Coconi , SDA (service du develppement agricole) ; Anochetus madagascarensis CASENT0011505 -12.86667 45.18333 Mayotte Mt. Benara Mt. Benara ; Anochetus madagascarensis CASENT0009058 -12.96667 45.16667 Mayotte Sazile Sazile ; Anochetus madagascarensis MCZ.12848w 0 0 Madagascar Nosy Be 5km SE Marodokana MADAGASCAR : Antsiranana : Nosy Be 5 km SE 0 0 Marodokana ; Anochetus madagascarensis CASENT0102932 0 0 Madagascar ridge behind Sambava, Q-37 ridge behind 0 0 Sambava , Q-37 ; Anochetus madagascarensis MCZ.7649w 0 0 Madagascar Antalaha 18 km North 0 0 Antalaha 18 km North ; COMORES Nossi be ;; Anochetus madagascarensis MCZ.12813w 0 0 Madagascar 68km SW of Sambava 68 km SW of 0 0 Sambava ; Anochetus madagascarensis MCZ.12814w 0 0 Madagascar Ambohitsara, 10km SW Antalaha Ambohitsara , 10 km SW 0 0 Antalaha ; Anochetus madagascarensis MCZ.12823w 0 0 Madagascar 2km W Antalaha 2 km W 0 0 Antalaha ; Anochetus madagascarensis MCZ.17755w 0 0 Madagascar Soavinandriana Soavinandriana ; Anochetus madagascarensis MCZ.8617w 0 0 Madagascar 2km S Antalaha 2 km S 0 0 Antalaha ; Anochetus madagascarensis CASENT0097105 -12.24694 49.37139 Madagascar Orangea, 3 km E Ramena [near fort] Orangea , 3 km E -12.24694 49.37139 Ramena [near fort] ; Anochetus madagascarensis CASENT0080880 -12.25889 49.37467 Madagascar Forêt d'Orangea, 3.6 km 128° SE Remena Foret d'Orangea , 3.6 km 128° SE -12.25889 49.37467 Remena ; COMORES Sakalava Beach ; COMORES 1 km W Sakalava Beach ; COMORES 3 km W Sakalava Beach ; COMORES Montagne des Francais , 7.2 km 142° SE Antsiranana ; Anochetus madagascarensis CASENT0008860 -12.325 49.33333 Madagascar Montaigne Francais Montaigne Francais ; COMORES 7 km N Joffreville ; Anochetus madagascarensis CASENT0416391 -12.46889 49.24217 Madagascar Réserve Spéciale d'Ambre, 3.5 km 235° SW Sakaramy Reserve Speciale d'Ambre , 3.5 km 235° SW -12.46889 49.24217 Sakaramy ; COMORES Parc National Montagne d'Ambre ; COMORES Parc National Montagne d'Ambre ; Anochetus madagascarensis CASENT0081446 -12.52028 49.17917 Madagascar Parc National Montagne d'Ambre [Petit Lac road] Parc National Montagne d'Ambre [Petit Lac road] ; Anochetus madagascarensis CASENT0416396 -12.53444 49.1795 Madagascar Parc National Montagne d'Ambre, 3.6 km 235° SW Joffreville Parc National Montagne d'Ambre , 3.6 km 235° SW -12.53444 49.1795 Joffreville ; Anochetus madagascarensis CASENT0059487 -12.80467 49.37383 Madagascar Rés. Analamerana, 16.7 km 123° Anivorano-Nord Res. Analamerana , 16.7 km 123° -12.80467 49.37383 Anivorano-Nord ; Anochetus madagascarensis CASENT0080888 -12.86361 49.22583 Madagascar Réserve Spéciale de l'Ankarana, 13.6 km 192° SSW Anivorano Nord Reserve Speciale de l'Ankarana , 13.6 km 192° SSW -12.86361 49.22583 Anivorano Nord ; Anochetus madagascarensis MCZ.7967w -12.9 49.1 Madagascar Ankarana Ankarana ; Anochetus madagascarensis MCZ.2870w -12.90056 49.14722 Madagascar Res. Ankarana Res. Ankarana ; Anochetus madagascarensis CASENT0080184 -12.90889 49.10983 Madagascar Réserve Spéciale de l'Ankarana, 22.9 km 224° SW Anivorano Nord Reserve Speciale de l'Ankarana , 22.9 km 224° SW -12.90889 49.10983 Anivorano Nord ; Anochetus madagascarensis CASENT0049282 -12.97 49.7 Madagascar Forêt d'Ampondrabe, 26.3km 10° NNE Daraina Foret d'Ampondrabe , 26.3 km 10° NNE -12.97 49.7 Daraina ; Anochetus madagascarensis CASENT0040872 -13.08333 49.90833 Madagascar Forêt d'Analabe, 30.0 km 72° ENE Daraina Foret d'Analabe , 30.0 km 72° ENE -13.08333 49.90833 Daraina ; Anochetus madagascarensis CASENT0043734 -13.11833 49.23 Madagascar Forêt d' Andavakoera, 21.4km 75° ENE Ambilobe; 4.6km 356° N Betsiaka Foret d' Andavakoera , 21.4 km 75° ENE -13.11833 49.23 Ambilobe ; 4.6 km 356° N -13.11833 49.23 Betsiaka ; Anochetus madagascarensis CASENT0043819 -13.16667 49.71 Madagascar Forêt de Bekaraoka, 6.8km 60° ENE Daraina Foret de Bekaraoka , 6.8 km 60° ENE -13.16667 49.71 Daraina ; Anochetus madagascarensis CASENT0041768 -13.21167 49.55667 Madagascar Forêt d' Antsahabe, 11.4km 275° W Daraina Foret d' Antsahabe , 11.4 km 275° W -13.21167 49.55667 Daraina ; Anochetus madagascarensis CASENT0041186 -13.255 49.61667 Madagascar Forêt de Binara, 7.5 km 230° SW Daraina Foret de Binara , 7.5 km 230° SW -13.255 49.61667 Daraina ; Anochetus madagascarensis CASENT0053711 -13.26333 49.60333 Madagascar Forêt de Binara, 9.1km 233° SW Daraina Foret de Binara , 9.1 km 233° SW -13.26333 49.60333 Daraina ; Anochetus madagascarensis MCZ.12855w -13.31667 48.31667 Madagascar Nosy Be, Airport Nosy Be , -13.31667 48.31667 Airport ; Anochetus madagascarensis MCZ.12844w -13.38139 48.31333 Madagascar Nosy Be, 5km Marodokana Nosy Be , 5 km -13.38139 48.31333 Marodokana ; Anochetus madagascarensis MCZ.12800w -13.39833 48.20611 Madagascar Nosy be, Ambatoloaka Nosy be , -13.39833 48.20611 Ambatoloaka ; Anochetus madagascarensis MCZ.12801w -13.41639 48.30722 Madagascar Nosy Be, Lokobe Forest Nosy Be , -13.41639 48.30722 Lokobe Forest; Anochetus madagascarensis MCZ10471-4.2394w -13.41667 48.3 Madagascar Nosy Be, 4 km ESE Andoany (=Hellville) Nosy Be , 4 km ESE -13.41667 48.3 Andoany (= -13.41667 48.3 Hellville ) ; Anochetus madagascarensis CASENT0007854 -13.41944 48.33117 Madagascar Nosy Be, Réserve Naturelle Intégrale de Lokobe, 6.3 km 112° ESE Hellville Nosy Be , Reserve -13.41944 48.33117 Naturelle Integrale de Lokobe , 6.3 km 112° ESE -13.41944 48.33117 Hellville ; Anochetus madagascarensis CASENT0054492 -13.4645 48.55167 Madagascar Forêt Ambato, 26.6 km 33° Ambanja Foret Ambato , 26.6 km 33° -13.4645 48.55167 Ambanja ; Anochetus madagascarensis CASENT0053749 -13.71533 50.10167 Madagascar Ambondrobe, 41.1km 175° Vohemar Ambondrobe , 41.1 km 175° -13.71533 50.10167 Vohemar ; Anochetus madagascarensis CASENT0416387 -13.79861 48.16167 Madagascar Ampasindava, Forêt d'Ambilanivy, 3.9 km 181° S Ambaliha Ampasindava , -13.79861 48.16167 Foret d'Ambilanivy, 3.9 km 181° S -13.79861 48.16167 Ambaliha ; Anochetus madagascarensis BLF1996(18)-3 -13.96167 48.43333 Madagascar R.S. Manongarivo, 10.8 km 229° SW Antanambao R.S. Manongarivo , 10.8 km 229° SW -13.96167 48.43333 Antanambao ; Anochetus madagascarensis BLF1862(01)-4 -13.97667 48.42333 Madagascar R.S. Manongarivo, 12.8 km 228° SW Antanambao R.S. Manongarivo , 12.8 km 228° SW -13.97667 48.42333 Antanambao ; Anochetus madagascarensis CASENT0460281 -14.30889 47.91433 Madagascar Forêt d'Anabohazo, 21.6 km 247° WSW Maromandia Foret d'Anabohazo , 21.6 km 247° WSW -14.30889 47.91433 Maromandia ; Anochetus madagascarensis CASENT0109757 -14.668 50.18667 Madagascar Forêt Ambohibato, 27.2 km 349° Antalaha Foret Ambohibato , 27.2 km 349° -14.668 50.18667 Antalaha ; Anochetus madagascarensis CASENT0109521 -14.67933 50.18367 Madagascar Forêt Ambanitaza, 26.1 km 347° Antalaha Foret Ambanitaza , 26.1 km 347° -14.67933 50.18367 Antalaha ; Anochetus madagascarensis MCZ.12812w -14.76667 50.21667 Madagascar 18km N Antalaha, Ampahana 18 km N -14.76667 50.21667 Antalaha , -14.76667 50.21667 Ampahana ; Anochetus madagascarensis MCZ.12812w -14.76667 50.21667 Madagascar 18km N Antalaha, Ampahana Anochetus madagascarensis MCZ.12812w -14.76667 50.21667 Madagascar 18km N Antalaha, Ampahana Anochetus madagascarensis MCZ.12882w -14.96056 50.27222 Madagascar 5km S + 5km W Antalaha 5 km S+5km W -14.96056 50.27222 Antalaha ; Anochetus madagascarensis MCZ0.484w -15 50.33333 Madagascar Antalaha, 12km S -15 50.33333 Antalaha , 12 km S ; Anochetus madagascarensis MCZ.12853w -15.05 50.15 Madagascar Marofinaritra Marofinaritra ; Anochetus madagascarensis MCZ611.11275w -15.29128 50.33803 Madagascar 14km W Cap Est, Ambato 14 km W Cap Est , -15.29128 50.33803 Ambato ; Anochetus madagascarensis CASENT0052518 -15.96267 47.43817 Madagascar Forêt Ambohimanga, 26.1 km 314° Mampikony Mahajanga : -15.96267 47.43817 Foret Ambohimanga , 26.1 km 314° -15.96267 47.43817 Mampikony ; Anochetus madagascarensis CASENT0425001 -16.22806 47.14361 Madagascar Parc National d'Ankarafantsika, Forêt de Tsimaloto, 18.3 km 46° NE de Tsaramandroso Parc National d'Ankarafantsika , -16.22806 47.14361 Foret de Tsimaloto , 18.3 km 46° NE de -16.22806 47.14361 Tsaramandroso ; Anochetus madagascarensis CASENT0064413 -16.31944 46.81333 Madagascar Ampijoroa National Park, 160 km N Maevatanana Ampijoroa National Park , 160 km N -16.31944 46.81333 Maevatanana , -16.31944 46.81333 Mahajanga Prov ., deciduous forest ; Anochetus madagascarensis CASENT0486367 -16.40667 45.31 Madagascar Parc National de Namoroka, 16.9 km 317° NW Vilanandro Parc National de Namoroka , 16.9 km 317° NW -16.40667 45.31 Vilanandro ; Anochetus madagascarensis CASENT0032650 -16.46667 45.35 Madagascar Parc National de Namoroka, 9.8 km 300° WNW Vilanandro Parc National de Namoroka , 9.8 km 300° WNW -16.46667 45.35 Vilanandro ; Anochetus madagascarensis CASENT0050216 -16.925 44.36833 Madagascar Réserve Spéciale de Bemarivo, 23.8 km 223° SW Besalampy Reserve Speciale de Bemarivo , 23.8 km 223° SW -16.925 44.36833 Besalampy ; Anochetus madagascarensis CASENT0466025 -19.13222 44.81467 Madagascar Parc National Tsingy de Bemaraha, 2.5 km 62° ENE Bekopaka, Ankidrodroa River Parc National Tsingy de Bemaraha , 2.5 km 62° ENE -19.13222 44.81467 Bekopaka , -19.13222 44.81467 Ankidrodroa River ; Anochetus madagascarensis CASENT0424741 -19.14194 44.828 Madagascar Parc National Tsingy de Bemaraha, 3.4 km 93° E Bekopaka, Tombeau Vazimba Parc National Tsingy de Bemaraha , 3.4 km 93° E -19.14194 44.828 Bekopaka , -19.14194 44.828 Tombeau Vazimba ; COMORES Toamasina : Ivondro p. Tamatave ; COMORES Ilat Prune bei Tamatave ; COMORES Tamatave ; Anochetus madagascarensis MCZ0.1108w 0 0 Madagascar Res. Betampona, Ambodiriana 45km NW Toamasina Res. Betampona , 0 0 Ambodiriana 45 km NW 0 0 Toamasina ; Anochetus madagascarensis CASENT0066826 -16.67233 49.70117 Madagascar Res. Ambodiriana, 4.8 km 306°Manompana, along Manompana river Res. Ambodiriana , 4.8 km 306° -16.67233 49.70117 Manompana , along -16.67233 49.70117 Manompana river ; COMORES Parcell K9 Tampolo ; Anochetus madagascarensis CASENT0006647 -17.28333 49.41667 Madagascar S.F. Tampolo, 10 km NNE Fenoarivo Atn. S.F. Tampolo , 10 km NNE -17.28333 49.41667 Fenoarivo Atn . ; Anochetus madagascarensis CASENT0006782 -17.28333 49.43333 Madagascar Parcelle E3 Tampolo Parcelle E3 Tampolo ; Anochetus madagascarensis CASENT0095521 -17.66667 49.5 Madagascar Mahavelona (Foulpointe) Mahavelona ( -17.66667 49.5 Foulpointe ) ; Anochetus madagascarensis CASENT0067011 -17.7095 49.454 Madagascar Analalava, 7.0 km 255° Mahavelona Analalava , 7.0 km 255° -17.7095 49.454 Mahavelona ; Anochetus madagascarensis CASENT0094743 -17.75 48.71667 Madagascar Manakambahiny Atsinanana Manakambahiny Atsinanana ; COMORES Foret Ambatovy , 14.3 km 57° Moramanga ; COMORES Torotorofotsy ; COMORES Andasibe National Park , botanic garden near eIntrance, West of ANGAP office ; Anochetus madagascarensis CASENT0080386 -18.96278 48.45267 Madagascar 7 km SE Andasibe National Park Headquarters 7 km SE Andasibe National Park Headquarters ; COMORES Fianarantsoa : COMORES Riv : Morongolo Aff de Rongaronga ; COMORES Local : Antanandava PK 285 RN2 ; Anochetus madagascarensis MCZ.8047w 0 0 Madagascar Nat. Pk.Ranomafana, Miaranony Forest Nat. Pk. Ranomafana , 0 0 Miaranony Forest ; Anochetus madagascarensis MCZ.12885w 0 0 Madagascar Ranomafana Nat. Park Ranomafana Nat. Park; Anochetus madagascarensis MCZ303.10041w 0 0 Madagascar Ranomafana Nat. Park, Vohiparara, Hotel Ranomafana Nat. Park, 0 0 Vohiparara , Hotel; Anochetus madagascarensis MCZ.12856w 0 0 Madagascar 8km NE Kianjavato, Vatovavy forest 8 km NE 0 0 Kianjavato , 0 0 Vatovavy forest ; Anochetus madagascarensis MCZ.8047w 0 0 Madagascar Nat. Pk.Ranomafana, Miaranony Forest Nat. Pk. Ranomafana , 0 0 Miaranony Forest ; Anochetus madagascarensis MCZ.8618w -21.16667 47.58333 Madagascar Ranomafana Nat. Park, Tsarahomanana Ranomafana Nat. Park , -21.16667 47.58333 Tsarahomanana ; Anochetus madagascarensis MCZ.8775w -21.26667 47.41667 Madagascar 7 km W Ranomafana 7 km W -21.26667 47.41667 Ranomafana ; Anochetus madagascarensis MCZ.12804w -21.38861 47.94361 Madagascar 8km E Kianjavato, Vatovavy Forest 8 km E -21.38861 47.94361 Kianjavato , -21.38861 47.94361 Vatovavy Forest ; Anochetus madagascarensis MCZ.12804w -21.38861 47.94361 Madagascar 8km E Kianjavato, Vatovavy Forest Anochetus madagascarensis MCZ.12804w -21.38861 47.94361 Madagascar 8km E Kianjavato, Vatovavy Forest 7.6 km 122° Kianjavato , COMORES ForetClassee Vatovavy ; Anochetus madagascarensis CASENT0071737 -22.14817 48.02267 Madagascar Manakara Manakara ; Anochetus madagascarensis CASENT0030375 -22.31333 45.29167 Madagascar Parc National d'Isalo, Sahanafa River, 29.2 km 351° N Ranohira Parc National d'Isalo , -22.31333 45.29167 Sahanafa River , 29.2 km 351° N -22.31333 45.29167 Ranohira ; Anochetus madagascarensis CASENT0489444 -22.59167 45.12833 Madagascar Forêt d'Analalava, 29.6 km 280° W Ranohira Foret d'Analalava , 29.6 km 280° W -22.59167 45.12833 Ranohira ; Anochetus madagascarensis CASENT0071172 -22.81967 47.83 Madagascar Farafangana Farafangana ; Anochetus madagascarensis CASENT0006632 -24.93694 46.75361 Madagascar 29.5 km WNW Tolanaro, Vasiha Mt. 29.5 km WNW -24.93694 46.75361 Tolanaro , -24.93694 46.75361 Vasiha Mt . ; Anochetus madagascarensis MCZ1107.2069w 0 0 Madagascar Andohahela, Parcel #1 versante E. Toliara : 0 0 Andohahela , Parcel #1 versante E.; Anochetus madagascarensis MCZ1107.2069w 0 0 Madagascar Andohahela, Parcel #1 versante E. Anochetus madagascarensis MCZ1107.2069w 0 0 Madagascar Andohahela, Parcel #1 versante E. Anochetus madagascarensis MCZ1107.2069w 0 0 Madagascar Andohahela, Parcel #1 versante E. 29 km NNW 0 0 Ranohira , 0 0 Isalo N.P .; Anochetus madagascarensis BLF1310(07)-1 -22.46667 44.85 Madagascar Vohibasia Forest, 59 km NE Sakaraha Vohibasia Forest , 59 km NE -22.46667 44.85 Sakaraha ; Anochetus madagascarensis CASENT0062938 -22.8405 44.73117 Madagascar near road, Zombitse National Park, Tulear Prov. near road, Zombitse National Park , -22.8405 44.73117 Tulear Prov .; Anochetus madagascarensis CASENT0062938 -22.8405 44.73117 Madagascar near road, Zombitse National Park, Tulear Prov. Anochetus madagascarensis CASENT0062938 -22.8405 44.73117 Madagascar near road, Zombitse National Park, Tulear Prov. Anochetus madagascarensis CASENT0063421 -22.8865 44.69217 Madagascar near ANGAP office, Zombitse National Park, Tulear Prov. near ANGAP office, Zombitse National Park , -22.8865 44.69217 Tulear Prov .; Anochetus madagascarensis CASENT0053302 -22.90367 43.4755 Madagascar Mikea Forest, deciduous dry forest, Tulear Province Mikea Forest , deciduous dry forest, Tulear Province ; Anochetus madagascarensis CASENT0052994 -22.91333 43.48222 Madagascar Mikea Forest, spiny forest, Tulear Province Mikea Forest , spiny forest, Tulear Province ; Anochetus madagascarensis CASENT0059253 -23.04457 43.61532 Madagascar Ranobe Ranobe ; Anochetus madagascarensis CASENT0035101 -23.23528 43.87083 Madagascar Fiherenana Fiherenana ; Anochetus madagascarensis BLF1476(08)-6 -23.65 44.63333 Madagascar Beza-Mahafaly, 27 km E Betioky Beza-Mahafaly , 27 km E -23.65 44.63333 Betioky ; Anochetus madagascarensis MCZ11893.5011w -23.65833 44.62889 Madagascar Beza-Mahafaly, Parcel 1 Beza-Mahafaly , Parcel 1 ; Anochetus madagascarensis CASENT0006631 -24.43806 47.21944 Madagascar 70.7 km NNE Tolanaro, Mahermano Mt. 70.7 km NNE -24.43806 47.21944 Tolanaro , -24.43806 47.21944 Mahermano Mt . ; Anochetus madagascarensis MCZ0.454w -24.73333 46.8 Madagascar Rés. Andohahela, 6 km SSW Eminiminy Res. Andohahela , 6 km SSW -24.73333 46.8 Eminiminy ; Anochetus madagascarensis CASENT0004381 -24.77167 47.17167 Madagascar 2.7 km WNW 302° Ste. Luce 2.7 km WNW 302° -24.77167 47.17167 Ste. Luce ; Anochetus madagascarensis MCZ.10456w -24.77639 46.70528 Madagascar Andohahela Andohahela ; Anochetus madagascarensis CASENT0003985 -24.92972 46.20967 Madagascar Réserve Privé Berenty, Forêt d'Anjapolo, 21.4 km 325° NW Amboasary Reserve Prive Berenty , -24.92972 46.20967 Foret d'Anjapolo, 21.4 km 325° NW -24.92972 46.20967 Amboasary ; Anochetus madagascarensis CASENT0061810 -24.93683 46.62667 Madagascar Tsimelahy - Parcel II, Andohahela National Park, transition forest, Tulear Province Tsimelahy - -24.93683 46.62667 Parcel II, -24.93683 46.62667 Andohahela National Park , transition forest, Tulear Province ; Anochetus madagascarensis BLF2040(46)-1 -24.95167 47.00167 Madagascar Mandena, 8.4 km NNE 30° Tolagnaro Mandena , 8.4 km NNE 30° -24.95167 47.00167 Tolagnaro ; Anochetus madagascarensis CASENT0003917 -24.95694 46.2715 Madagascar Réserve Privé Berenty, Forêt de Bealoka, Mandraré River, 14.6 km 329° NNW Amboasary Reserve Prive Berenty , -24.95694 46.2715 Foret de Bealoka , -24.95694 46.2715 Mandrare River , 14.6 km 329° NNW -24.95694 46.2715 Amboasary ; Anochetus madagascarensis CASENT0003929 -25.00778 46.306 Madagascar Réserve Privé Berenty, Forêt de Malaza, Mandraré River, 8.6 km 314° NW Amboasary Reserve Prive Berenty , -25.00778 46.306 Foret de Malaza , -25.00778 46.306 Mandrare River , 8.6 km 314° NW -25.00778 46.306 Amboasary ; Anochetus madagascarensis MCZ11852.4134w -25.01667 46.3 Madagascar Réserve Berenty Reserve Berenty ; Anochetus madagascarensis MCZ.12881w -25.01778 46.30611 Madagascar Res. Berenty -25.01778 46.30611 Res. Berenty ; Anochetus madagascarensis BLF2072(34)-1 -25.06167 46.87 Madagascar Forêt de Petriky, 12.5 km W 272° Tolagnaro -25.06167 46.87 Foret de Petriky , 12.5 km W 272° -25.06167 46.87 Tolagnaro . Anochetus pattersoni Fishersp. nov.urn:lsid:zoobank.org:act:A1B9370B-2286-41D0-8E28-335C3514A76A Figures: worker 7a-d; queen 7e,f; male 7g,h, 8d Type Material: Holotype: worker, CASENT0068352 -9.392777 46.203888 Seychelles SeychellesAldabra Group, Picard Island , in old '' -9.392777 46.203888 Settlement''09°23'34"S046°12'14"E 5 m, mostly -9.392777 46.203888 Casuarina with coco palms, exotic vegetation, found after dark on concrete slab in abandoned settlement 19-Dec-05 (coll. S.M.Goodman ) collection code: SMG14998 CASENT0068352 1w ( CASC ) . CASENT0068352-D01 -9.392777 46.203888 Seychelles CO1 barcode from same collection as holotype and labeled CASENT0068352-D01 Worker measurements: maximum and minimum based on all specimens, n = 8, (holotype): HL 1.32-1.40 (1.40), HW 1.25- 1.31 (1.31), CI 93-95 (94), EL 0.20-0.26 (0.23), ML 0.67-0.72 (0.72), MI 50-51 (51), SL 1.07-1.15 (1.15) SI 85-88 (88), WL 1.62-1.79 (1.78), FL 1.11-1.20 (1.19), PW 0.70-0.76 (0.74). Queen measurements: maximum and minimum based on n= 1. HL 1.31, HW 1.29, CI 99, EL 0.30, ML 0.64, MI 49, SL 1.05, SI 81, WL 1.81, FL 1.15, PW 0.79. Male measurements: maximum and minimum based on n = 2 from Madagascar: HL 0.86-0.87, HW 1.07-1.10, CI 124- 126, EL 0.65-0.67, SL 0.18, SI 17, WL 1.72-1.77, FL 1.21-1.26 Worker Diagnosis: Dorsal margin of petiole node concave medially (not visible in figures of the workers but easily seen in the queen in Figure 7f.) Anterior portion of pronotal dorsum lightly sculptured compared to posterior portion of pronotum. Propodeal dorsum and angle transversely coarsely rugose, declivitous face below angle with transverse striae, with sculpture thinning near base of face; propodeum angulate in lateral view. Petiole scale broad; anterior half of first gastral tergum smooth and shiny with only fine punctures at base of setae. This species is most similar to the graeffei a widespread species across the Indo-Pacific, but differs from the latter by the pattern of sculpture on the mesosomal dorsum, shape the petiole (concave), broader petiole node as seen in lateral view, and its much larger size (HL+ML 1.99-2.12 mm in pattersoni ,HL+ML<1.75 mm in graeffei). Distribution and biology. This species is limited to the Aldabra group islands with most collections from Isle Picard. References and records to Anochetus madagascarensis [e.g. Forel 25:159] most likely refer to this species. No other species of Anochetus have been recorded from the Seychelles. Males have been collected in Malaise traps, and a queen with clear wing scares. Diagnostic barcoding loci: A. pattersoni : G-183, G-264, A- 399, A-489, A-505, A-552. Additional material examined for Anochetus pattersoni : In addition to the type material, specimens from the following localities were examined in this study. CASENT0102280 Seychelles Seychelles : Aldabra Group : South Island ( Grand Terre ), Dune Patates5- Jun-74 (Coll: V. Spaull ) CASENT0102280 3w ( BMNH ) ; CASENT0103343 Seychelles Isle Picard 12-25 Mar- 85 ( Col : P.Mundel ) CASENT0103343 1dQ CASENT0103344 Seychelles CASENT0103344 1w ( CASC ), MCZ .3680w 1w (MCZC) ; Seychelles Ile PicardSettlement , 11 ; CASENT0172374 Seychelles (ANIC32-015992) 1-Nov-68 (coll: W.F.Humphreys ) CASENT0172374 1w ( ANIC ) ; Seychelles Ile Polymnie , Anse Cedres , 155 ; CASENT0172375 Seychelles (ANIC32-015991) 1-Nov-68 (coll: W.F.Humphreys ) CASENT0172375 1w ( ANIC ) ; Anochetus pattersoni CASENT0172609 0 0 Seychelles Cosmoledo, Menai 0 0 Cosmoledo , 0 0 Menai17- Dec-05 (col: J.Gerlach ) CASENT0172609 1w ( LACM ) ; Anochetus pattersoni CASENT0172610 0 0 Seychelles Grande Terre, Aldabra Grande Terre , 0 0 Aldabra15-Dec-05 ; CASENT0172610 Seychelles (coll: J.Gerlach ) CASENT0172610 1w ( LACM ) ; Anochetus pattersoni CASENT0172611 0 0 Seychelles Aldabra Islands, Picard Aldabra Islands , 0 0 Picard22-29 Sep-05 ex malaise trap 6 m (coll: K.Mach & O.Maurel ) CASENT0172611 1 m (LACm) ; Anochetus pattersoni CASENT0172617 0 0 Seychelles Aldabra Islands, Picard Aldabra Islands , 0 0 Picard22-26 May-05 (coll: K.Mach & O.Maurel ) CASENT0172617 1 m ( LACM ) . Check-List of Malagasy Odontomachus Species coquereli Roger , 1861 = coquereli minor Emery, 1899 troglodytes Santschi , 1914 = haematodus stanleyi Wheeler 1922 simillimus Smith 1858 = haematoda breviceps, Crawley 1915 = haematodes fuscipennis Forel 1913 = pallidicornis Smith , F. 1860 Key to workers and queens of Malagasy Odontomachus (modified from Brown [1:117] 1. Head narrow behind eyes; mandible with long, acute apical and preapical teeth; vertex of head coarsely, transversely striate............................... coquereli Head only slightly narrower across vertex than across eyes, with distinct extraocular furrows and temporal ridges; apical and preapical teeth of mandible short and blunt; vertex finely striate longitudinally, diverging behind ............... 2 2. Metasternal process acute, forming paired, slender spines, often unequal in length (Fig. 13a). Petiole spine notably bent posteriorly at base...................... troglodytes Metasternal process low, rounded (Fig. 13b). Petiole spine slightly curved posteriorly, comma but not noticeably bent posteriorly at base of spine................ simillimus Key to males of Malagasy Odontomachus 1. Shortest distance between lateral ocellus and margin of compound eye smaller than maximum length of ocellus. Antenna with suberect setae; declivitous surface of propodeum without distinct rugae (Madagascar) .......... coquereli Shortest distance between lateral ocellus and margin of compound eye distinctly greater than maximum length of ocellus. Antenna with very short appressed to decumbent setae; declivitous surface of propodeum with distinct rugae directed towards margins ............................... 2 2. Body brownish yellow. Tarsal claw with small subapical tooth (Madagascar) ......................... troglodytes Body blackish or brown. Tarsal claw without subapical tooth (Seychelles)........................... simillimus Odontomachus coquereli RogerFigures: worker 1b, 10a,b, 13c; queen 10c,d; male 11a,b,e; map 14a Type material: Odontomachus coquereli Roger , 1861: 30 [26]. Lectotype: worker, CASENT0104549 Madagascar Madagascar ( Coquerel ) ( ZMHB ), present designation [examined] AntWeb CASENT0104549 . Odontomachus coquereli minor Emery 1899: 273 [27]. Lectotype; worker, CASENT0102021 Madagascar Madagascar , Baie d' Antongil ( Mocquerys ) ( MSNG ), present designation [examined] AntWeb CASENT0102021 . Synonymized with coquereli by Brown, 1978: 557 [2]. Worker measurements: maximum and minimum based on n = 45 from Madagascar: HL 2.69-3.27, HW (across vertex) 1.26- 1.77, HW (across upper eye margin) 1.54-2.02, CI 57-67, EL 0.46-0.55, ML 1.76-2.16, MI 61-68, SL 3.04-3.96, SI 164-207, WL 4.18-5.11. FL 3.32-4.68, PW 1.11-1.53. Queen measurements: maximum and minimum based on n = 5 from Madagascar: HL 2.81-2.94, HW (across vertex) 1.39- 1.55, HW (across upper eye margin) 1.83-1.98, CI 62-71, EL 0.45-0.55, ML 1.66-1.81, MI 59-62, SL 3.07-3.29, SI 155-179, WL 4.35-4.56, FL 3.60-3.84, PW 1.28-1.43. Preapical teeth count 7-10. Male measurements: maximum and minimum based on n = 5 from Madagascar: HL 1.11-1.22, HW 1.41-1.57, CI 128- 134, EL 0.78-0.90, SL 0.30-0.38, SI 21-23, WL 3.38-3.85, FL 2.90-3.16. Worker Diagnosis: Workers of this species can be easily distinguished from troglodytes by their larger size, mandible with long, acute apical and preapical teeth and lack of extraocular furrows and temporal ridges on vertex. Brown [2] provides a description and additional references. Distribution and biology. O. coquereli is endemic to Madagascar and is restricted to eastern and northern montane rainforest, lowland rainforest, and littoral forest from 10 to 1325 m (Fig. 10a). It is most abundant at mid-elevations in the northeast such as in Marojejy National Park. Nests of O. coquereli are most commonly found in rotten logs and consist of small colonies. Queens of coquereli are wingless and very similar to workers; colonies reproduce by fission [28]. Males are collected in Malaise traps and yellow pan traps. Workers forage on the ground day and night. A few times BLF has seen solitary foragers high up on trunks and branches of large trees. It is not clear if they are foraging for plant or insect liquids up in the canopy. There is notable geographic variation in shape of petiole, sculpture and number of preapical teeth. Preapical teeth and denticles range from 7-12. Occasionally, adjacent teeth may be fused at base to form a single bidententate tooth. However, there is no consistent concordant pattern to this variation. Molecular data are also extremely variable - suggesting that these isolated populations have long been separated. Rather than describing these populations as distinct species, we leave them here as a single species - a hypothesis that can be tested in the future with subsequent experiments in both the field and lab. CO1: The barcode region is extremely variable (Fig. 16) - there is evident isolation by distance which is largely concordant with the biogeographic regions proposed by Wilme et al. [29]. Diagnostic barcoding loci. O. coquereli : T-96, C-196, T-211, T-280, A-283. Discussion: Odontomachus coquereli from Madagascar, the only species in the genus where winged queens have never been found. Molet et al. [28] investigated the Marojejy population of O. coquereli , and based on demography, morphometry, allometry and ovarian dissections demonstrated that the winged queen caste has been replaced by a wingless reproductive caste and that the strategy of colonial reproduction is fission. A single wingless reproductive (ergatoid) was found in each colony. The smallest colonies consisted of at least 5 workers and the largest colonies never exceeded 40 workers, indicating a threshold size at which a colony divides in two daughter colonies. In coIntrast, O. troglodytes reproduces by non-claustral independent foundation and colonies can reach 1300 workers [30]. As in A. goodmani and A. boltoni , the other species without winged queens - there are deep CO1 divergences between different collection localities. Specimens examined for Odontomachus coquereli : Specimens from 134 separate collection events from the following 57 localities were examined. Odontomachus coquereli CASENT0043293 -13.26333 49.6 MADAGASCAR Forêt de Binara, 9.4km 235° SW Daraina MADAGASCAR : Province Antsiranana : -13.26333 49.6 Foret de Binara , 9.4 km 235° SW -13.26333 49.6 Daraina ; Odontomachus coquereli BLF1902-01 -13.97667 48.42333 Madagascar R.S. Manongarivo, 12.8 km 228° SW Antanambao R.S. Manongarivo , 12.8 km 228° SW -13.97667 48.42333 Antanambao ; Odontomachus coquereli BLF1938(65)-09 -13.99833 48.42833 Madagascar R.S. Manongarivo, 14.5 km 220° SW Antanambao R.S. Manongarivo , 14.5 km 220° SW -13.99833 48.42833 Antanambao ; Odontomachus coquereli CASENT0170481 -14.43333 49.78333 Madagascar RNI Marojejy, 8 km NW Manantenina RNI Marojejy, 8 km NW -14.43333 49.78333 Manantenina ; CASENT0009409 Parc National de Marojejy , Manantenina River , Figure 10. Odontomachus spp. full face and lateral view. A-B, coquereli worker CASENT0009409 . CASENT0104947 C-D, coquereli ergatoid queen CASENT 0104947 . CASENT0100313 E-F, troglodytes worker CASNET0047308. G-H, troglodytes dealate queen CASENT0100313 . 27.6 km 35° NE Andapa ; Parc National de Marojejy , Manantenina River , 28.0 km 38° NE Andapa ; Parc National de Marojejy , AIntranohofa , 26.6 km 31° NNE Andapa ; Odontomachus coquereli CASENT0107134 -14.67933 50.18367 Madagascar Forêt Ambanitaza, 26.1 km 347° Antalaha Foret Ambanitaza , 26.1 km 347° -14.67933 50.18367 Antalaha ; Res. Anjanaharibe-Sud , 6.5 km SSW Befingotra , ; Odontomachus coquereli BLF0995-01 -15.56667 50 Madagascar 6.9 km NE Ambanizana, Ambohitsitondroina Res. D' Anjanaharibe-Sud , 17 km W -15.56667 50 Andapa ; Odontomachus coquereli BLF0995-01 -15.56667 50 Madagascar 6.9 km NE Ambanizana, Ambohitsitondroina Province Toamasina : 6.9 km NE -15.56667 50 Ambanizana , -15.56667 50 Ambohitsitondroina ; Odontomachus coquereli CASENT0488698 -15.17833 49.635 Madagascar Montagne d'Anjanaharibe, 19.5 km 27° NNE Ambinanitelo Montagne d'Anjanaharibe , 19.5 km 27° NNE -15.17833 49.635 Ambinanitelo ; Odontomachus coquereli CASENT0495034 -15.18833 49.615 Madagascar Montagne d'Anjanaharibe, 18.0 km 21° NNE Ambinanitelo Montagne d'Anjanaharibe , 18.0 km 21 ° NNE -15.18833 49.615 Ambinanitelo ; Odontomachus coquereli CASENT0049291 -15.28833 49.54833 Madagascar Montagne d'Akirindro 7.6 km 341° NNW Ambinanitelo Montagne d'Akirindro 7.6 km 341° NNW -15.28833 49.54833 Ambinanitelo ; Parc National Masoala , Ambanizana ,; Odontomachus coquereli CASENT0100305 -15.66667 49.96667 Madagascar 5.3 km SSE Ambanizana, Andranobe 5.3 km SSE -15.66667 49.96667 Ambanizana , Andranobe ; Odontomachus coquereli MCZ187.9934w -15.69361 50.18139 Madagascar 1km W Andampibe, Cap Masoala 1 km W -15.69361 50.18139 Andampibe , Cap Masoala ; Odontomachus coquereli CASENT0069941 -16.455 49.7875 Madagascar Parc National Mananara-Nord, 7.1 km 261° Antanambe Parc National Mananara-Nord , 7.1 km 261 ° -16.455 49.7875 Antanambe ; Odontomachus coquereli CASENT0066828 -16.67233 49.70117 Madagascar Res. Ambodiriana, 4.8 km 306°Manompana, along Manompana river Res. Ambodiriana , 4.8 km 306° -16.67233 49.70117 Manompana , along Manompana river ; Odontomachus coquereli CASENT0066835 -16.9225 49.88733 Madagascar Ile Sainte Marie, Forêt Kalalao, 9.9 km 34° Ambodifotatra Ile Sainte Marie , Foret Kalalao, 9.9 km 34° -16.9225 49.88733 Ambodifotatra ; Odontomachus coquereli CASENT0049243 -17.28333 49.43333 Madagascar Parcelle E3 Tampolo Parcelle E3 -17.28333 49.43333 Tampolo ; Odontomachus coquereli CASENT0095663 -17.66667 49.5 Madagascar Mahavelona (Foulpointe) -17.66667 49.5 Mahavelona ( -17.66667 49.5 Foulpointe ) ; Odontomachus coquereli CASENT0095583 -17.66667 49.5 Madagascar Mahavelona (Foulpointe), Forest Andalava -17.66667 49.5 Mahavelona ( -17.66667 49.5 Foulpointe ), Forest Andalava ; Odontomachus coquereli CASENT0066854 -17.88667 49.2025 Madagascar Reserve Betampona, Camp Vohitsivalana, 37.1 km 338° Toamasina Reserve Betampona , -17.88667 49.2025 Camp Vohitsivalana , 37.1 km 338° -17.88667 49.2025 Toamasina ; Odontomachus coquereli CASENT0066853 -17.924 49.19967 Madagascar Reserve Betampona, Camp Rendrirendry 34.1 km 332° Toamasina Reserve Betampona , -17.924 49.19967 Camp Rendrirendry 34.1 km 332° -17.924 49.19967 Toamasina ; Odontomachus coquereli HJR052-02 -18.695 48.81333 Madagascar F.C. Andriantantely -18.695 48.81333 F.C. Andriantantely ; Odontomachus coquereli CASENT0170572 -18.95 48.46667 Madagascar 6km ESE Andasibe (=Perinet) 6 km ESE -18.95 48.46667 Andasibe (= Perinet) ; Odontomachus coquereli CASENT0170575 0 0 Madagascar Nat. Pk.Ranomafana, Miaranony Forest Province Fianarantsoa : Nat. Pk. Ranomafana, 0 0 Miaranony Forest ; Odontomachus coquereli MCZ.9932w 0 0 Madagascar Ranomafana Nat. Park, Valoloaka forest Ranomafana Nat. Park , 0 0 Valoloaka forest ; Odontomachus coquereli CASENT0009489 -21.8275 47.33889 Madagascar Forêt d'Ambalagoavy Nord, Ikongo, Ambatombe Foret d'Ambalagoavy Nord , -21.8275 47.33889 Ikongo , -21.8275 47.33889 Ambatombe ; Odontomachus coquereli BLF0693-01 -22.21667 47.01667 Madagascar 45km S. Ambalavao 45 km S. -22.21667 47.01667 Ambalavao ; Res. Andringitra , 43 km S Ambalavao . Odontomachus simillimus Smith : Figures: worker 12a,b, 13b; queen 12c,d; male 12e,f; Type material: Odontomachus simillimus Smith , 1858: 80 [31]. Type locality: Fiji Islands [not examined]. Junior synonym of haematodus by Roger, 1861: 24 [26]; revived from synonymy by Wilson, 1959: 499 [32]. Odontomachus haematoda var. breviceps, Crawley , 1915: 239 [33]. Type locality: Australia Christmas Island , Australia ( BMNH ) [not examined]. Synonymized with simillimus by Brown, 1976: 106 [1]. Odontomachus haematodes var. fuscipennis Forel 1913: 19 [34].Type locality: Peradeniya, Sri Lanka (MNHB?) [not examined]. Synonymized with simillimus by Wilson, 1959: 499 [32]. Ponera pallidicornis Smith , F. 1860: 73 [35]. Type locality: Makassar Makassar , Celebes ( BMNH ) [not examined] . Synonymized with simillimus by Brown, 1976: 106 [1]. Worker measurements: maximum and minimum based on n = 10 from Madagascar: HL 2.33-2.63, HW (across vertex) 1.64- 2.03, HW (across upper eye margin) 1.77-2.06, CI 75-81, EL 0.20-0.23, ML 1.14-1.28, MI 48-51, SL 2.16-2.43, SI 109-123, WL 2.62-3.06. FL 2.29-2.56, PW 1.02-1.24. Queen measurements: maximum and minimum based on n = 5 from Madagascar: HL 2.37-2.55, HW (across vertex) 1.79- 2.03, HW (across upper eye margin) 1.87-2.13, CI 79-84, EL 0.49-0.53, ML 1.17-1.30, MI 49-52, SL 2.15-2.38, SI 111-118, WL 3.13-3.19. FL 2.36-2.58. Male measurements: maximum and minimum based on n = 1 from Madagascar: HL 0.89, HW 1.19, CI 133, EL 0.59, SL 0.19, SI 16, WL 2.44. FL 1.73. Worker diagnosis: Workers and males are very similar in morphology and size to troglodytes Bivariate plots of metric measurements did not distinguish the two species. Workers and queen have fine, glossy dorsal striation on head and mesosoma. Metasternal process low and rounded (Fig. 13b). Metasternal process can be viewed in mounted specimens by removing a hind leg and coxa. Brown [1] provides a description and additional references. Distribution and biology. Known though most of the literature as ''O. haematodes'' (Linnaeus) 1758 which is a different species. Forel's [25:159] record of ''O. haematodes'' from Seychelles, Mahe most likely refers to simillimus . Found in clearings and secondary growth throughout the IndoPacific. The records from the Seychelles clearly represent an introduction. O. simillimus is not known from Madagascar and may have difficulty in establishing on Madagascar because of the presence of the morphologically and ecologically similar O. troglodytes . CO1. The average within species CO1 divergence for O. simillimus was 3.212% with much variation between islands (Max 5.786, SE = 0.273). Importantly, although bivariate plots of worker measurements do not reliably separate O. simillimus from the ecologically similar O. troglodytes , the two species are, on average, 7-8% divergent within the CO1 barcode. Diagnostic barcoding loci. O. simillimus : C-265, T-267, T- 528. Specimens examined for Odontomachus simillimus : Additional details are provided for the specimens from Seychelles. INDONESIA INDONESIA : Irian Jaya , Maffin Bay ; PT. Freeport Concession, Siewa Camp ; PAPUA NEW GUINEA PAPUA NEW GUINEA : Los Negros , Admiralty Islands ; Milne Bay , Morobe , Finschhafen , Biak Island ; PHILIPPINES PHILIPPINES : Leyte , Tacloban ; Odontomachus simillimus CASENT0172666 0 0 Seychelles Silhouette Island, Grande Barbe SEYCHELLES : Silhouette Island , 0 0 Grande Barbe , 7/22-23/2000 , J.Gerlach ; Odontomachus simillimus CASENT0172667 0 0 Seychelles Silhouette Island, Jardin Marron Silhouette Island , 0 0 Jardin Marron , 7/5/2000 , J.Gerlach ; SOLOMON ISLANDS SOLOMON ISLANDS : Kungana Bay , Rennell Island ; Guadalcanal , Tenaru River ; Kungana Bay , Rennell Island , Anuda Island ; NW end of Bellona Island ; Tevia Bay , Vanikoro Island , Santa Cruz Islands ; Mohawk Bay , Matema Island , Santa Cruz Islands , Pavuvu , Russell Island ; VANUATU VANUATU : Espiritu Santo Island . Odontomachus troglodytes SantschiFigures: worker 10e,f, 13a; queen 10g,h; male 11c,d,f; map 14b Type material: Odontomachus haematodes troglodytes Santschi , 1914: 58 [36]. Lectotype worker: CASENT0101134 Kenya Kenya , Shimoni cave ( NHMB ), designated by Brown, 1976: 106 [2] [examined] AntWeb CASENT0101134 . Raised to species Brown, 1976: 106 [1]. Odontomachus haematodus stanleyi Wheeler , 1922: 102 [37]. Type worker: DRC ( CASENT0104653 0.5 25.166666 Zaire Zaire ) 0.5 25.166666 Stanleyville , 25° 10'E , 0°30'NFeb 1915 , ( AMNH ) [examined] AntWeb CASENT0104653 , CASENT0104654 0.5 25.166666 Zaire CASENT0104654 . Synonymized with troglodytes by Brown, 1976: 106 [1]. Worker measurements: maximum and minimum based on n = 15 from Madagascar: HL 2.23-2.66, HW (across vertex) 1.56- 1.92, HW (across upper eye margin) 1.69-1.98, CI 74-78, EL 0.40-0.47, ML 1.13-1.33, MI 45-54, SL 2.07-2.42, SI 117-127, WL 2.61-3.07. FL 2.28-2.65, PW 1.02-1.19. The specimens from Madagascar are notably smaller than specimens in CAS collection from South Africa , ceIntral Africa and Sao Tome. Maximum and minimum measurements based on n = 5: HL 2.52-2.94, HW (across vertex) 1.81-2.25, HW (across upper eye margin) 1.94-2.31, CI 74-79, EL 0.41-0.51, ML 1.19- 1.38, MI 47-49, SL 2.24-2.53, SI 110-122, WL 2.88-3.23. FL 2.42-2.91, PW 1.13-1.36. Queen measurements: maximum and minimum based on n = 5 from Madagascar: HL 2.59-2.74, HW (across vertex) 1.99- 2.19, HW (across upper eye margin) 2.05-2.18, CI 78-79, EL 0.56-0.59, ML 1.39-1.44, MI 52-55, SL 2.36-2.52, SI 112-119, WL 3.18-3.49. FL 2.67-2.76. Male measurements: maximum and minimum based on n = 5 from Madagascar: HL 1.00-1.04, HW 1.30-1.35, CI 127- 133, EL 0.68-0.70, SL 0.22-0.26, SI 17-19, WL 2.52-2.59. FL 1.80-1.88 Worker Diagnosis: Workers of this species can be easily distinguished from coquereli by their smaller size, distinct extraocular furrows and temporal ridges on vertex and short and blunt mandibular teeth. Brown (1976) provides additional description and references. Distribution and biology. O. troglodytes was first reported from Madagascar by Andre [38:290] as O. haematodes (Linnaeus) . African and Malagasy records of haematodes actually refer to troglodytes . In Madagascar, troglodytes is widespread throughout the east in secondary habitats, including coastal scrub, eucalyptus Map shows major ecoregions: east (light gray): rainforest, ceIntral (dark gray): montane forest; west (white): tropical dry forest; southwest (medium gray): desert spiny bush thicket. doi:10.1371/journal.pone.0001787.g014 plantations, littoral forest, and rainforest below 800 m elevation. This species is also widespread across sub-Saharan Africa in second growth forests and open habitats. Forel [25:159] recorded Odontomachus (as haematodes ) from Seychelles. These specimens have not been examined but probably refer to O. simillimus and not troglodytes . Because of its preference of secondary habitats, it is possible that troglodytes in Madagascar is a recent colonist from Africa, possibly introduced by humans. This is in coIntrast to coquereli which is most closely related to Melanesian species in the tyrannicus group. Our collections in Madagascar were focused primarily on less disturbed habitats, thus the distribution map (Fig. 10b) probably does not reflect the full extent of its range. O. troglodytes was most often recorded nesting in rotten logs (30 collection records) followed by sifted litter (15). Males were collected at light, malaise traps, and yellow pan traps. A lab colony was kept for a number of months and thrived on a diet of crickets, producing numerous larvae, brood, and males. The trap jaw behavior is very similar to that of O. bauri [39, Fisher unpublished]. When disturbed, the specimen use trap jaw propulsion to ''jump'' away. CO1. Shallow iIntraspecific and deep interspecific divergences between O. troglodytes in Madagascar and Africa and the other species - what one might expect if it has been recently introduced. Average within species sequence divergence of 0.4% (Figs 15, 17). Diagnostic barcoding loci. O. troglodytes : G-1659, G-465, G- 519, T-535, A-537. Specimens examined for Odontomachus troglodytes : Specimens from 105 separate collection events from the following 40 localities were examined. CAMEROON CAMEROON : Sud : Res. de Faune de Campo , 2.16 km 106° ESE Ebodje ; CAMEROON Sud-Ouest : Bimbia Forest , 7.4 km 119° ESE Limbe . CENTRAL AFRICAN REPUBLIC CENTRAL AFRICAN REPUBLIC : Prefecture Sangha-Mbaere : Parc National Dzanga-Ndoki , 39.6 km 174° S -174.00 Lidjombo ; CENTRAL AFRICAN REPUBLIC Parc National Dzanga-Ndoki , 38.6 km 173° S -173.00 Lidjombo ; CENTRAL AFRICAN REPUBLIC Parc National Dzanga-Ndoki , 37.9 km 169° S -169.00 Lidjombo ; CENTRAL AFRICAN REPUBLIC Reserve Speciale de Foret Dense de Dzanga-Sangha , 12.7 km 326° NW Bayanga ; CENTRAL AFRICAN REPUBLIC Parc National Dzanga-Ndoki , Mabea Bai , 21.4 km 53° NE Bayanga . GABON GABON : Estuaire : Pointe Ngombe , Ekwata , 16 km 240° WSW Libreville ; Libreville ; GABON F.C. Mondah , 21 km 331° NNW Libreville . GABON GABON : Ogooue-Maritime : Aire d'Exploit . Rationnelle de Faune des Monts Doudou , 25.2 km 304° NW Doussala ; GABON Reserve de la Moukalaba-Dougoua , 12.2 km 305 NW Doussala ; GABON Reserve de Faune de la Moukalaba-Dougoua, 12.2 km 305° NW Doussala ; GABON Reserve de Faune de la Moukalaba-Dougoua, 10.8 km 214° SW Doussala ; GABON Woleu-Ntem : 31.3 km 108° ESE Minvoul ; KENYA KENYA : [Cote d' Afrique or. angl. Shimoni ; LIBERIA LIBERIA : Sapo Nat. Park . Odontomachus troglodytes MCZ1107.1590w 0 0 MADAGASCAR Mahavelona (=Foulpointe) MADAGASCAR : Toamasina : Mahavelona (= 0 0 Foulpointe ); 5.3 km SSE 0 0 Ambanizana , 0 0 Andranobe ; MADAGASCAR Foret d'AnalavaMandrisy , 5.9 km 195° Antanambe ; Odontomachus troglodytes CASENT0066827 -16.67233 49.70117 Madagascar Res. Ambodiriana, 4.8 km 306°Manompana, along Manompana river Res. Ambodiriana , 4.8 km 306° -16.67233 49.70117 Manompana , along -16.67233 49.70117 Manompana river ; Odontomachus troglodytes CASENT0066509 -16.82433 49.96417 Madagascar Ile Sainte Marie, Forêt Ambohidena, 22.8 km 44° Ambodifotatra Ile Sainte Marie , -16.82433 49.96417 Foret Ambohidena , 22.8 km 44° -16.82433 49.96417 Ambodifotatra ; Odontomachus troglodytes CASENT0067007 -16.91117 49.93917 Madagascar Ile Sainte Marie, Forêt Ampanihy, 14.4 km 52° Ambodifotatra Ile Sainte Marie , -16.91117 49.93917 Foret Ampanihy , 14.4 km 52° -16.91117 49.93917 Ambodifotatra ; Odontomachus troglodytes CASENT0066836 -16.9225 49.88733 Madagascar Ile Sainte Marie, Forêt Kalalao, 9.9 km 34° Ambodifotatra Ile Sainte Marie , -16.9225 49.88733 Foret Kalalao , 9.9 km 34° -16.9225 49.88733 Ambodifotatra ; MADAGASCAR Parcell K9 Tampolo ; Odontomachus troglodytes CASENT0048916 -17.28333 49.41667 Madagascar Tampolo -17.28333 49.41667 Tampolo ; Odontomachus troglodytes CASENT0009615 -17.28333 49.43333 Madagascar S.F. Tampolo, 10 km NNE Fenoarivo Atn. S.F. Tampolo, 10 km NNE -17.28333 49.43333 Fenoarivo Atn .; Odontomachus troglodytes CASENT0047308 -17.28333 49.43333 Madagascar Parcelle E3 Tampolo Parcelle E3 -17.28333 49.43333 Tampolo ; Odontomachus troglodytes CASENT0047308 -17.28333 49.43333 Madagascar Parcelle E3 Tampolo Odontomachus troglodytes CASENT0047308 -17.28333 49.43333 Madagascar Parcelle E3 Tampolo Odontomachus troglodytes CASENT0047086 -17.28333 49.41667 Madagascar Parcelle K7 Tampolo Parcelle K7 -17.28333 49.41667 Tampolo ; Odontomachus troglodytes CASENT0096039 -17.65 49.46667 Madagascar Bridge at Onibi, NW of Mahavelona Bridge at Onibi , NW of -17.65 49.46667 Mahavelona ; Odontomachus troglodytes CASENT0095534 -17.66667 49.5 Madagascar Mahavelona (Foulpointe) Mahavelona ( -17.66667 49.5 Foulpointe ); 2.1 km 315° -17.66667 49.5 Mahavelona ; Odontomachus troglodytes CASENT0095590 -18.16667 49.38333 Madagascar (Tamatave); Prison de Tamatave Toamasina ( -18.16667 49.38333 Tamatave ); -18.16667 49.38333 Prison de Tamatave ; Odontomachus troglodytes MCZ1107.1915w 0 0 Madagascar Station forest de Tampolo, 10km N Fenerive Station forest de Tampolo , 10 km N 0 0 Fenerive ; Odontomachus troglodytes MCZ0.1674w 0 0 Madagascar Res. Betampona, Ambodiriana 45km NW Toamasina Res. Betampona , 0 0 Ambodiriana 45 km NW 0 0 Toamasina ; Odontomachus troglodytes CASENT0170569 -18.79194 49.08667 Madagascar 10k N Brickaville 10k N -18.79194 49.08667 Brickaville ; Odontomachus troglodytes CASENT0170568 -18.9 49.13333 Madagascar 11km SE Ampasimanolotra (=Brickaville) 11 km SE -18.9 49.13333 Ampasimanolotra (= -18.9 49.13333 Brickaville ); Odontomachus coquereli CASENT0170576 0 0 MADAGASCAR Ranomafana Fianarantsoa : Riv: 0 0 Ranomafana 0 0 Aff. de laroka ; Odontomachus coquereli CASENT0170576 0 0 MADAGASCAR Ranomafana Local : 0 0 Ranomafana RN2; Odontomachus coquereli CASENT0170576 0 0 MADAGASCAR Ranomafana Odontomachus coquereli CASENT0170576 0 0 MADAGASCAR Ranomafana Riv: laroka Aff de Rianila; MADAGASCAR Local : Manakana ; MADAGASCAR Riv : Mahatsara Aff de Rianila ; Odontomachus troglodytes CASENT0122210 -18.82183 49.07017 Madagascar Brickaville Local : -18.82183 49.07017 Piste vers Brickaville ; MADAGASCAR Riv : Rongaronga ; MADAGASCAR Local : Ambodifaho ; MADAGASCAR Riv : Rianila ( Ivohitra ) ; MADAGASCAR Local : Antseranambe ; MADAGASCAR Riv : Santaravina ; MADAGASCAR Local : Ampasipotsy-pont routier ; MADAGASCAR Riv : Sandragniro ; MADAGASCAR Local : Tanambao-Pont routier ; MADAGASCAR Riv : Farimbogna ; MADAGASCAR Local : Village 202 ( Pont routier RN2 ) ; MADAGASCAR Riv : Ilazana ; MADAGASCAR Local : Gri-gri ; Odontomachus troglodytes CASENT0170571 0 0 Madagascar 8k E Kianjavato Vatovavy Forest 8k E 0 0 Kianjavato Vatovavy Forest ; Odontomachus troglodytes MCZ.7693w 0 0 Madagascar Ranomafana Nat. Park 0 0 Ranomafana Nat. Park ; Odontomachus troglodytes CASENT0170570 -18.99972 48.95 Madagascar 10k E Ranomafana 10k E -18.99972 48.95 Ranomafana ; Odontomachus troglodytes MCZ.7983w -18.99972 48.95 Madagascar Ranomafana Nat. Park, 10km E Ranomafana Nat. Park , 10 km E; -18.99972 48.95 Mananjary 2 km south; 7.6 km 122° -18.99972 48.95 Kianjavato , -18.99972 48.95 Foret Classee Vatovavy ; SOUTH AFRICA SOUTH AFRICA : Mpumalanga : Songimuelo Nat. Reserve , Kromdraai Camp , Komati River ; SOUTH AFRICA Natal : Mtunzini ; SOUTH AFRICA Limpopo : Dunstable Farm , 27 km E ofHoedspruit . DEMOCRATIC REPUBLIC OF THE CONGO DEMOCRATIC REPUBLIC OF THE CONGO : Stanleyville ; Epulu . Complementary analyses to CO1 In some instances we chose to amplify independent nuclear markers to help interpret CO1 divergences involving populations where specimens were morphologically cryptic. Because of their high copy number and relatively conserved primer regions, we selected three ribosomal regions to amplify: 18S , 28S and ITS1. We had high expectations for the utility of these markers to complement the mtDNA barcode analysis based on our own experiences with other taxa [40,41], the utility of these markers in other taxonomic groups where, for instance, ITS1 functions as a barcode [42], and, for 28S , based on predictions of others for the utility of this region as an alternative barcode region [43]. Unfortunately, we found that, while the CO1 data from species with exclusively (putatively) ergatoid queens had large phylogeographic signal, when compared to the three rRNA regions we utilized it was markedly simpler to generate, interpret and analyze. The rRNA markers utilized here, particularly 18S and 28S , can be useful for identifying interspecific (species as revised here) hybridization [see 40,41,43]. Discussion The role of CO1 barcoding in taxonomic revision In traditional morphology-based taxonomy, morphologically discrete forms are tentatively recognized and hypothesized to be species. Taxonomists search for consistent phenotypic discontinuities that may indicate the occurrence of reproductive isolation. Many ant species, however, show considerable geographical variation in morphological characters. An additional complication for morphology-based taxonomy is the difference between castes within the same species, e.g. males, major and minor workers, and queens. Sequence data provide an alternative set of characters to assist in inferring species boundaries. In addition, like morphological data, hypotheses can be evaluated in light ofadditional data on specimen distribution, biology, and behavior. In the example of Anochetus of Madagascar, sequence data impacted the taxonomic process at the following steps: Caste association. Caste association, including male/female association, is a powerful contribution to taxonomic studies, especially for ants, which vary tremendously in morphology between sexes and castes. In this study, CO1 divergence was the principal source of data for revealing that small and large workers and queens are the same species. Though no morphological distinction in addition to size between the forms was noted, it remained unclear whether they belonged to the same species since no colony collection contained both size classes, even though they are often collected at the same site. One explanation is that small workers are produced by small queens. Small queens may represent an alternative reproductive strategy and may be only rarely produced by large queens. Further research will explore the reproductive biology of this species. The sequence data also confirmed the association of males collected in Malaise traps with the worker caste. Type designation. The identities of many valid names are in question in Madagascar because insufficient geographic and morphological information was provided in their original descriptions, or type specimens are of uninformative minor worker castes or are damaged. For Anochetus , description of new species included the DNA barcode of a specimen from the paratype colony series to provide an additional tool for associating the name with type specimens. This facilitates linking the name to the type specimen if the identity of the type is called into question. Evolutionary questions and biogeographic patterns. Sequencing revealed patterns of geographic coherence and divergence that were not revealed in morphological analysis. A good example ofthis is the deep divergence in isolated populations of A. goodmani , and O. coquereli (see Species as hypotheses below). These results will direct future morphological and evolutionary studies on these divergent populations. Identification. In-depth morphological study, a more timeconsuming process than the DNA analysis undertaken in this study, was applied to outliers identified by the DNA analysis. For example, in the inventory described in part I, 22 collections of Anochetus from three species were included. All were correctly identified using sequence data. Specimens within the same species that showed high sequence divergence, however, were culled for morphological scrutiny (e.g. A. madagascarensis from Amato and Binara). Biogeography. This combination of traditional taxonomy and DNA barcoding has produced a wealth of biogeographic hypotheses to be tested. Do more basal lineages have more restricted or wider distributions, compared to younger taxa? Are evident patterns ofgenetic isolation by distance within the ergatoid ponerines examined here shared by all those with wingless queens? Are the mechanisms of isolation the same? Do the phylogeographic groupings correspond with the Wilme et al. [29] biogeographic regions hypothesized largely as related to primates? Taxonomy has always had this style of iterative hypothesis testing, but adding an explicit molecular component as with DNA barcoding - allows these hypotheses to be more transparent. Species as hypotheses The existence of any species is a hypothesis to be tested, and the transparency of species delimitation is one of the major additions that DNA barcoding brings to systematics. In our analysis, the deep sequence divergences within A. goodmani suggests that populations from the north and south of western Madagascar have a long history of isolation, and could in fact be separate species (Fig. 6). However, there are alternate hypotheses. This species has wingless queens. Species of ants that lack winged queens, reproduce by fission and have reduced dispersal ability, particularly when measured using a maternally inherited genetic marker. Thus, we might expect that those populations now restricted to isolated relict pockets of moist habitat in the dry west would show deep divergence [for example - 44-46], and represent distinct, evolutionary significant units [47], if not distinct species. By coIntrast in A. madagascarensis and A. grandidieri , where only winged queens have been observed, within-species sequence divergences are much lower. We are currently testing the hypothesis that female-limited dispersal has caused the extremely site-specific phylogeographic signal by assaying nuclear genes. It is possible that these populations, separated at such a large spatial scale, will show strong genetic differentiation for both nuclear and mtDNA markers between localities [44]. The CO1 analysis does not unequivocally indicate that A. goodmani is more than one species, but it does suggest future hypotheses of species membership to be tested. Molecular approaches to species identification have been criticized for potentially overestimating [48,49], and/or underestimating biodiversity. Species diversity will be underestimated when collections include quickly evolving species-pairs [9] where interspecific divergences are less than or equal to iIntraspecific variation. Our data set contains one potential example of this phenomenon: individuals of Anochetus goodmani collected from Binara on the north east coast and Parc National de Kirindy Mite on the south west coast. Individuals from these populations are separated by, on average, 6.0% sequence divergence. Are these populations operating as separate species? Are these populations members of the same species but highly divergent? Our data alone cannot answer this question. But, of critical import, our data have identified a surprising level of within-species divergence and lays bare these differences to further study. A standard arthropod molecular clock for CO1 is 1.2-1.5% per million years [50-52]. In hymenopterans the rate for this gene is accelerated [53], and therefore average estimates should be interpreted with caution. However, the higher rates suggest that populations have been isolated for several hundred thousand years. The opportunity now exists to employ a suite of approaches (behavioral observations, tests of interbreeding, and phylogeographic resolution of more quickly evolving genetic markers) to test species membership. CO1 and complementary genetic analyses Of all the molecular data used here, the CO1 data was by far the easiest to generate and interpret. While an inter-gene/genomic comparison of utility was not the intent of this research, we feel it important to comment on these differences here, while presenting a full multigene phylogeographic analysis of the covariance of genetic diversity and geographic separation in another manuscript. Within the context of a species description or revision, the relevant information here is that: 1) The CO1 barcode was very easy to generate. While the majority of specimens analyzed here are between 1-2 years old, we did generate full length barcodes (>600 bp) for specimens up to 14 years old. Barcodes were generated with the same primers and reaction conditions. Alternatively, rRNA data, variable at a species level, was often challenging to generate (i.e. sequence) due to long regions of t-repeats and uncharacterized iIntra-individual variation (in ITS1). 2) We found no evidence for Numts [54] or other misplaced nuclear markers that would introduce conflict into our analysis if not spotted. 3) CO1 sequences never showed iIntra-individual variation as did some of the rRNA markers. 4) Although the species described here (especially O. coquereli , A. goodmani and A. boltoni ) contain large CO1 divergences, such variation is always geographically segregated, as one might expect from a species where the queens (when known) are ergatoid. In the worst-case scenario, by describing species containing large iIntra-specific CO1 divergences, we have missed morphologically cryptic diversity within these species. However, the DNA data, collection records, measurements and photo-digital accessions are all preserved in publicly accessible databases, facilitating the testing (and potential refutation) of our one-species hypothesis in the traditional, iterative, process of alpha-taxonomy. Collaborative Taxonomy Species inventories are essential for documenting global diversity and generating necessary material for taxonomic study. However, for inventories to be relevant in the short term, the taxonomic process must reduce the bottlenecks in describing and identifying specimens. The shear diversity ofarthropods can easily overwhelm an inventory system with too many specimens, the bulk of which are outside the focal expertise of the taxonomists. As an example, the NSF-funded Arthropod Inventory of Madagascar has shipped over a third of million specimens to over 150 participating taxonomic collaborators [5]. Major taxonomic products from these inventories, which will take decades to produce, represent only a fraction of the diversity collected, and provide no short-term return of biodiversity data to Madagascar. The development of collaborative taxonomy'' would permit researchers to participate collectively in an accelerated teamdriven taxonomic process. Key participants in collaborative taxonomy are (i) inventory teams led by conservationists, ecologists, and taxonomists, (ii) traditional morphology-based taxonomists equipped with imaging tools, and (iii) geneticists. Under this plan, inventory teams would generate specimens and sequence data in collaboration with geneticists. Geneticists, in turn, would work directly with the taxonomist who identifies the need for additional sequencing of specimens. Taxonomists would then combine extensive sequencing data with their morphological and ecological analysis, assisted by new technologies in digital imaging and web-based delivery (e.g. www.antweb.org and www. barcodinglife.org), to infer species limits and frame evolutionary context for species. Nothing can replace the countless hours of careful observation necessary to understand variation and to delimit species boundaries. However, the addition of sequence data provides a means to create short-term results from inventories and at the same time generate data helpful to taxonomists. For taxonomists, sequencing highlights the specimens most deserving of focused study. We tested this collaborative model by revising the ant genera Anochetus and Odontomachus of Madagascar using a combination of morphological and genetic character sets based on inventories in Madagascar. Future This study demonstrates how sequence data, combined with morphological analysis and innovations in imaging and web delivery, have set the stage for accelerated discovery and documentation of global species diversity. The combination of DNA sequence data with inventory and traditional taxonomy is a model that can be applied across disciplines and will allow analytical needs to scale to the enormity of the biodiversity crisis [55]. It will help in the identification and conservation of the evolutionary processes that generate and preserve biodiversity. Little time remains to document and protect global biodiversity. Taxonomists, equipped with modern tools and collaborations, have a chance to move systematics to the forefront ofconservation and the public's attention. With increased taxonomic output and improved public access and visibility, public support for the discovery of life on this planet will follow. Supporting Information Appendix S1 Accessions and collection information for all sequences created in this study. Found at: doi:10.1371/journal.pone.0001787.s001 (0.64 MB XLS) Appendix S2 This is the current article provided as a TaxonX XML document. TaxonX models taxonomic treatments and allows semantic enhancement so machines can understand, mine and extract the content (see http://plazi.org). Found at: doi:10.1371/journal.pone.0001787.s002 (0.11 MB RTF) Acknowledgments We thank April Nobile for creating the images. We thank Alma Saucedo and Kelly Herbinson for assistance with measurements and Taika von Konigslow and Kate Crosby for their diligent assistance in the lab. Barry Bolton, James Trager, Wojciech Pulawski provided careful reviews of earlier drafts of the manuscript. Richard Pyle kindly provided the first Formicidae LSIDs for the new names described herein. Author Contributions Conceived and designed the experiments: BF MS. Performed the experiments: BF MS. Analyzed the data: BF MS. Contributed reagents/ materials/analysis tools: BF MS. Wrote the paper: BF MS. References 1. Brown WL Jr. (1976) Contributions toward a reclassification of the Formicidae. Part VI. Ponerinae, tribe Ponerini, subtribe Odontomachiti. Section A. Introduction, subtribal characters. Genus Odontomachus. Studia Entomologica 19: 67-171. 2. Brown WL Jr. (1978) Contributions toward a reclassification of the Formicidae. Part VI. Ponerinae, tribe Ponerini, subtribe Odontomachiti. Section B. Genus Anochetus and bibliography. Studia Entomologica 20: 549-638. 3. Brady SG, Schultz TR, Fisher BL, Ward PS (2006) Evaluating alternative hypotheses for the early evolution and diversification of ants. Proceedings ofthe National Academy of Sciences of the United States of America 103: 18172-18177. 4. Ouellette GD, Fisher BL, Girman DJ (2006) Molecular systematics of basal subfamilies of ants using 28S rRNA (Hymenoptera: Formicidae). Molecular Phylogenetics and Evolution 40: 359-369. 5. Fisher BL (2005) A Model for a Global Inventory of Ants: A Case Study in Madagascar. In: Jablonski NG, ed. Proceedings of the California Academy of Sciences 56: 78-89. 6. Polaszek A, Agosti D, Alonso-Zarazaga M, Beccaloni G, de Place Bj0rn P, Bouchet P, Brothers DJ, Earl of Cranbrook, Evenhuis N, Godfray HCJ, Johnson NF, Krell F-T, Lipscomb D, Lyal CHC, Mace GM, Mawatari S, Miller SE, Minelli A, Morris S, Ng PKL, Patterson DJ, Pyle RL, Robinson N, Rogo L, TaverneJ, Thompson FC, van TolJ, Wheeler QD, Wilson EO (2005) Commentary: A universal register for animal names. Nature 437: 477.165. 7. Polaszek A, Alonso-Zarazaga M, Bouchet P, Brothers DJ, Evenhuis N, Krell F- T, Lyal CHC, Minelli A, Pyle RL, Robinson NJ, Thompson FC, van Tol J (2005) ZooBank: the open-access register for zoological taxonomy: Technical Discussion Paper. Bulletin of Zoological Nomenclature 62: 210-220. 8. Pyle RL, Earle JL, Greene BD (2008) Five new species ofthe damselfish genus Chromis (Perciformes: Labroidei: Pomacentridae) from deep coral reefs in the tropical western Pacific. Zootaxa 1671: 3-31. 9. Hebert PDN, Cywinska A, Ball SL, DeWaard JR (2003) Biological identifications through DNA barcodes. Proceedings ofthe Royal Society ofLondon Series B-Biological Sciences 270: 313-321. 10. Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences of the United States ofAmerica 101: 14812-14817. 11. Hajibabaei M, DeWaard JR, Ivanova NV, Ratnasingham S, Dooh RT, et al. (2005) Critical factors for assembling a high volume of DNA barcodes. Philosophical Transactions of the Royal Society B-Biological Sciences 360: 1959-1967. 12. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98. 13. Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120. 14. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406-425. 15. Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Briefings in Bioinformatics5: 150-163. 16. Ratnasingham S, Hebert PDN (2007) BOLD: The Barcode ofLife Data System (www.barcodinglife.org). Molecular Ecology Notes 7: 355-364. 17. Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585-595. 18. Rozas J, Rozas R (1999) DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15: 174-175. 19. Lou M, Golding GB (2007) fingerprint: visual depiction ofvariation in multiple sequence alignments Molecular Ecology Notes: doi: 10.1111/j.1471- 8286.2007.01904.x. 20. Braig HR, Zhou W, Dobson SL, O'Neill SL (1998) Cloning and Characterization of a Gene Encoding the Major Surface Protein of the Bacterial Endosymbiont Wolbachia pipientis. Journal of Bacteriology 180: 2373-2378. 21. Forel A (1891) Les Formicides. [part] In: Grandidier A, ed. Histoire physique, naturelle, et politique de Madagascar. Volume XX. Histoire naturelle des Hymenopteres. Deuxieme partie (28e fascicule). Paris: Hachette et Cie. pp v+237. 22. Santschi F (1928) Descriptions de nouvelles fourmis ethiopiennes (quatrieme note). Revue de Zoologie et de Botanique Africaines 16: 54-69. 23. Forel A (1887) Fourmis recoltees a Madagascar par le Dr. Conrad Keller. Mitteilungen der Schweizerischen Entomologischen Gesellschaft 7: 381-389. 24. Forel A (1918) Quelques fourmis de Madagascar recoltees par le Dr. Friederichs et quelques remarques sur d'autres fourmis. Bulletin de la Societe Vaudoise des Sciences Naturelles 52: 151-156. 25. Forel A (1912) The Percy Sladen Trust Expedition to the Indian Ocean in 1905, under the leadership of Mr. J. Stanley Gardiner, M.A. Volume 4. No. XI. Fourmis des Seychelles et des Aldabras, recues de M. Hugh Scott. Transactions ofthe Linnean Society ofLondon. Zoology (2)15: 159-167. 26. Roger J(1861) Die Ponera-artigen Ameisen (Schluss). Berliner Entomologische Zeitschrift 5: 1-54. 27. Emery C (1899) Formiche di Madagascar raccolte dal Sig. A. Mocquerys nei pressi della Baia di Antongil (1897-1898). Bullettino della Societa Entomologica Italiana 31: 263-290. 28. Molet M, Peeters C, Fisher BL (2007) Permanent loss ofwings in queens ofthe ant Odontomachus coquereli from Madagascar. Insectes Sociaux 54: 183-188. 29. Wilme L, Goodman SM, Ganzhorn JU (2006) Biogeographic evolution of Madagascar's microendemic biota. Science 312: 1063-1065. 30. Colombel P (1971) Etude biometrique du couvain et des adultes d' Odontomachus haematodes (Hym. Form. Poneridae). Annales de la Faculte des Sciences, UniversiteFederale du Cameroun 6: 53-71. 31. Smith F (1858) Catalogue of hymenopterous insects in the collection of the British Museum. Part VI. Formicidae. London: British Museum (Natural History). 216 p. 32. Wilson EO (1959) Studies on the ant fauna of Melanesia V. The tribe Odontomachini. Bulletin of the Museum of Comparative Zoology 120: 483-510. 33. Crawley WC (1915) Ants from north and south-west Australia (G. F. Hill, Rowland Turner) and Christmas Island, Straits Settlements. Part II. Ann. Mag. Natur. Hist., 15: 232-239. 34. Forel A (1913) Ameisen aus Sumatra, Java, Malacca und Ceylon. Gesammelt von Herrn Prof. Dr. v. Buttel-Reepen in den Jahren 1911-1912. Zoologische Jahrbucher Abteilung fur Systematik Okologie und Geographie der Tiere 36: 1-148. 35. Smith F (1860) Descriptions of new species of hymenopterous insects collected by Mr. A. R. Wallace at Celebes. Journal of the Proceedings of the Linnean Society ofLondon, Zoology 5: 57-93. 36. Santschi F (1914) Voyage de Ch. Alluaud et R. Jeannel en Afrique Orientale, 1911-1912. Resultats scientifiques. Insectes Hymenopteres. II. Formicidae. Paris: Libr. A. Schulz. pp 41-148. 37. Wheeler WM (1922) Ants of the American Museum Congo expedition. A contribution to the myrmecology of Africa. II. The ants collected by the American Museum Congo Expedition. Bulletin of the American Museum of Natural History 45: 39-269. 38. Andre E (1887) Description de quelques fourmis nouvelles ou imparfaitement connues. Revue d'Entomologie (Caen) 6: 280-298. 39. Patek SN, Baio JE, Fisher BL, Suarez AV (2006) Multifunctionality and mechanical origins: Ballistic jaw propulsion in trap-jaw ants. Proceedings ofthe National Academy of Sciences of the United States of America 103: 12787-12792. 40. Smith MA, Wood DM, Janzen DH, Hallwachs W, Hebert PDN (2007) DNA barcodes affirm that 16 species of apparently generalist tropical parasitoid flies (Diptera, Tachinidae) are not all generalists. Proceedings of the National Academy of Sciences of the United States of America 104: 4771-4772. 41. Smith MA, Woodley NE, Janzen DH, Hallwachs W, Hebert PDN (2006) DNA barcodes reveal cryptic host-specificity within the presumed polyphagous members of a genus of parasitoid flies (Diptera: Tachinidae). Proceedings of the National Academy of Sciences of the United States of America 103: 3657-3662. 42. Seifert KA, Samson RA, Dewaard JR, Houbraken J, Levesque CA, et al. (2007) Prospects for fungus identification using C01 DNA barcodes, with Penicillium as a test case. Proceedings ofthe National Academy ofSciences ofthe United States of America 104: 3901-3906. 43. Sonnenberg R, Nolte AW, Tautz D (2007) An evaluation ofLSU rDNA D1-D2 sequences for their use in species identification. Frontiers in Zoology 4. 44. Doums C, Cabrera H, Peeters C (2002) Population genetic structure and malebiased dispersal in the queenless ant Diacamma cyaneiventre. Molecular Ecology 11: 2251-2264. 45. Giraud T, Blatrix R, Poteaux C, Solignac M, Jaisson P (2000) Population structure and mating biology of the polygynous ponerine ant Gnamptogenys striatula Brazil. Molecular Ecology 9: 1835-1841. 46. Ross KG, Krieger MJB, Shoemaker DD, Vargo EL, Keller L (1997) Hierarchical analysis of genetic structure in native fire ant populations: results from three classes of molecular markers. Genetics 147: 643-655. 47.CrandallKA,Bininda-EmondsORP,MaceGM,WayneRK(2000) Considering evolutionary processes in conservation biology. Trends in Ecology & Evolution 15: 290-295. 48. Harris JD, Froufe E (2005) Taxonomic inflation: species concept or historical geopolitical bias? Trends in Ecology & Evolution 20: 6-7. 49. Isaac NJB, Mallet J, Mace GM (2004) Taxonomic inflation: its influence on macroecology and conservation. Trends in Ecology & Evolution 19: 464-469. 50. Caccone A, Sbordoni V (2001) Molecular biogeography, evolutionary rates, and morphological adaptations to cave life: a case study using Bathysciine beetles and sequence data from the mitochondria CO1 gene. Evolution 55: 122-130. 51. Farrell BD (2001) Evolutionary assembly of the milkweed fauna: cytochrome oxidase 1 and the age of Tetraopes beetles. Molecular Phylogenetics and Evolution 18: 469-478. 52. Dick CW, Roubik DW, Gruber KF, Bermingham E (2004) Long-distance gene flow and cross-Andean dispersal of lowland rainforest bees (Apidae: Euglossini) revealed by comparative mitochondrial DNA phylogeography. Molecular Ecology 13: 3775-3785. 53. Hebert PDN, Ratnasingham S, deWaard JR (2003) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London Series B-Biological Sciences 270: S96-S99. 54. Bensasson D, Zhang D, Hartl DL, Hewitt GM (2001) Mitochondrial pseudogenes: evolution's misplaced witnesses. Trends in Ecology & Evolution 16: 314-321. 55. DeSalle R, Amato G (2004) The expansion of conservation genetics. Nature Reviews Genetics 5: 702-712. 56. Hebert PD, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences of the United States ofAmerica 101: 14812-14817. 57. Hajibabaei M, deWaard JR, Ivanova NV, Ratnasingham S, Dooh R, et al. (2005) Critical factors for the high volume assembly of DNA barcodes. Philosophical Transactions of the Royal Society of London B Biological Sciences. 58. Hajibabaei M, Janzen DH, Burns JM, Hallwachs W, Hebert PDN (2006) DNA barcodes distinguish species of tropical Lepidoptera. Proceedings ofthe National Academy of Sciences of the United States of America 103: 968-971. 59. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, et al. (1994) Evolution, Weighting, and Phylogenetic Utility of Mitochondrial Gene-Sequences and a Compilation of Conserved Polymerase Chain-Reaction Primers. Annals of the Entomological Society ofAmerica 87: 651-701. 60. Smith MA, Fisher BL, Hebert PDN (2005) DNA barcoding for effective biodiversity assessment of a hyperdiverse arthropod group: the ants of Madagascar. Philosophical Transactions of the Royal Society B-Biological Sciences 360: 1825-1834. 61. Ji Y-J, Zhang D-X, He L-J(2003) Evolutionary conservation and versatility ofa new set of primers for amplifying the ribosomal internal transcribed spacer regions in insects and other invertebrates. Molecular Ecology Notes 3: 581-585. 62. Saux C, Fisher BL, Spicer GS (2004) Dracula ant phylogeny as inferred by nuclear 28S rDNA sequences and implications for ant systematics (Hymenoptera: Formicidae: Amblyoponinae). Molecular Phylogenetics and Evolution 33: 457-468. 63. Hillis DM, Dixon MT (1991) Ribosomal DNA: Molecular Evolution and Phylogenetic Inference. Quarterly Review of Biology 66: 411-453. Figure 1. oblique dorsal view of head. A, Anochetus madagascarensis .B, Odontomachus coquereli . doi:10.1371/journal.pone.0001787.g001 Table 1. Primers used to generate sequences and molecular tests. Primer NamePrimer sequence (5'-3')Amplicon regionPrimer sourceUsed for sequencing (Y/N)LepF1ATTCAACCAATCATAAAGATATTGGCO1[56]YLepR1TAAACTTCTGGATGTCCAAAAAATCACO1[56]YMLepF1GCTTTCCCACGAATAAATAATACO1[57]YMLepR1CCTGTTCCAGCTCCATTTTCO1[58]YC_ANTMR1D-RonIIdeg_RGGRGGRTARAYAGTTCATCCWGTWCCCO1[Modified from 59]NC_ANTMR1D-AMR1deg_RCAWCCWGTWCCKRMNCCWKCATCO1[Modified from 60]NCAS18Fs1TACACACCGCCCGTCGCTACTATS1[61]YCAS5p8s1BdATGTGCGTTCRAAATGTCGATGTTCATS1[Modified from 61]YD2BGTCGGGTTGCTTGAGAGTGC28S[62]YD3ArTCCGTGTTTCAAGACGGGTC28S[62]Y18H3AGGGTCGATTCCGGAGAGGGAGCCTGAGAA18S[63]Y185WRCTTGGCAAATGCTTTCGC18S[63]Ywsp 81FTGGTCCAATAAGTGATGAAGAAACWolbachia surface protein[20]Ywsp 691RAAAAATTAAACGCTACTCCAWolbachia surface protein[20]Y Figure 2. Anochetus spp. full face and lateral view. A-B, boltoni worker CASENT0104542 . C-D, boltoni male CASENT0063847 . E-F, goodmani worker CASENT0104543 . G-H, goodmani ergatoid queen CASENT0454531 . doi:10.1371/journal.pone.0001787.g002 Figure 3. Anochetus grandidieri full face and lateral view. A-B, large worker CASENT0497580 . C-D, small worker CASENT0033463 . E-F, large queen CASENT0041177 . G-H, small queen CASENT0498467 . I -J, male CASENT0049858 . doi:10.1371/journal.pone.0001787.g003 Figure 4. Anochetus madagascarensis full face and lateral view. A-B, worker CASENT0104547 . C-D, queen CASENT0498419 . E-F, male CASENT0049282 . doi:10.1371/journal.pone.0001787.g004 Figure 5. Anochetus workers, upper part of petiole from front view. A, boltoniCASENT0104542 . B, goodmaniCASENT0104543 . C, grandidieri (large form) CASENT0497580 . D, madagascarensisCASENT0498309 . doi:10.1371/journal.pone.0001787.g005 Figure 6. collection localities of Anochetus specimens in Madagascar. Map shows major ecoregions: east (light gray): rainforest, ceIntral (dark gray): montane forest; west (white): tropical dry forest; southwest (medium gray): desert spiny bush thicket. doi:10.1371/journal.pone.0001787.g006 Figure 7. Anochetus pattersoni . A-D Worker holotype CASENT0102280 full face, lateral view, upper part of petiole from rear view, dorsal view. E-F, queen paratype CASENT0103343 full face and lateral view. G-H, male CASENT0172617 full face and lateral view. doi:10.1371/journal.pone.0001787.g007 Figure 8. Anochetus males, terminalia, lateral view. A, boltoniCASENT0063847 . B, grandidieriCASENT0080660 . B, madagascarensis CASENT0063421 . D, pattersoniCASENT0172617 . doi:10.1371/journal.pone.0001787.g008 Figure 8. Anochetus males, terminalia, lateral view. A, boltoniCASENT0063847 . B, grandidieriCASENT0080660 . B, madagascarensisCASENT0063421 . D, pattersoniCASENT0172617 . doi:10.1371/journal.pone.0001787.g008 PLoS ONE | www.plosone.org Figure 9. NJ tree of K2P for five species of Anochetus in Madagascar, Comoros and Aldabra (all specimens with.500 bp). Deep divergences evident between madagascarensis , grandidieri , and goodmani are evident. Deep divergences within A. goodmani are evident (In this tree, A. boltoni falls within goodmani ). The rightmost column of colors differentiate which biogeographical groupings of Wilme et al. [29] these populations fall. WCE-1 = Binara, Antsahabe. WCE-12 = Andavakoera, Ankarana. WCE-7= Kirindy Mite. WRDW-B = Vazimba, Androngonibe, Andranopasazy. doi:10.1371/journal.pone.0001787.g009 Table 2. Anochetus goodmani within-species pair-wise partitioning of genetic variance for the CO1 DNA barcode. K2P distances are beneath the diagonal and the number substitutions are above the diagonal. Table 3. Comparison of the utility of various complimentary nuclear markers for species diagnosis in the ponerine ants of the Malagasy. Taxa18S28SITS1Comments Anochetus goodmani Intra - no variation. nter - 2 bp from A. boltoni , and 3 bp from O. troglodytes , O. coquereli Intra - no variation across north nter -.15 bp divergent from A. madagascarensis . Intra - extreme variation (length and substitution) across range. Some corresponding to deep CO1 splits - provisionally orthologous. However, deep paralogous divergences have been sequenced within single individuals through different amplifications and extractions.rRNA is, a priori, difficult to differentiate orthologous from paraologous. Not as immediately useful as an independent marker without cloning. Anochetus boltoni Intra - no variation. nter - 2 bp from A. goodmani , 2 bp from O. troglodytes and no difference from O. coquereli . N/AIntraspecific variation of 1% (indels and substitutions) between the two sampled populations. Anochetus madagascarensisN/A Intra - no variation. nter -.15 bp divergent from A. goodmani . Intra - variation that does NOT reflect CO1 variation.rRNA is, a priori, difficult to differentiate orthologous from paraologous. Not as immediately useful as an independent marker without cloning. -Positive Wolbachia test. Anochetus grandidieriN/AN/ALow iIntraspecific variation that does reflect CO1 geographic variation.- Positive Wolbachia test. Anochetus pattersoniN/AN/AN/A Odontomachus coquereli Intra - no variation. nter - 2 bp from O. troglodytes . 2bp from A. boltoni ,and 3 bp from A. goodmani . Intra - variation. Large variation at geographically distal ends of distribution. nter - differentiates between three Malagasy species.Intraspecific variation that only partially reflects geography and CO1 variation - while some clearly does not. Paralogous and orthologous Odontomachus troglodytes Intra - no variation. nter - 2 bp from O. coquereli . 3 bp from A. boltoni ,and3bp from A. goodmani . Intra - some variation that does not correspond to geography or CO1. nter - does not differentiate between O. simillimusIntraspecific variation that only partially reflects geography and CO1 variationAll specimens tested positive for Wolbachia. Odontomachus simillimusN/A Intra - no variation. nter - does not differentiate O. troglodytesN/A Figure 11. Odontomachus spp. males full face, lateral view, and oblique lateral view of terminalia. A, B, and E, coquereliCASENT0063858 . C, D, and F, troglodytesCASENT0096412 . doi:10.1371/journal.pone.0001787.g011 Figure 12. Odontomachussimillimus full face and lateral view. A- B, worker CASENT0172667 . C-D, queen CASENT0172668 . E-F, male CASENT0172666 . doi:10.1371/journal.pone.0001787.g012 Figure 13. Odontomachus spp. ventral aspect of posterior mesosoma viewed from underneath and from rear with coxa and petiole removed to show metasternal process. A, troglodytesCASENT0009961 . B, simillimusCASENT0009988 . C, coquereli CAS- NET0009962. doi:10.1371/journal.pone.0001787.g013 Figure 14. collection localities of Odontomachus in Madagascar. Figure 15. NJ tree of K2P for three species of Odontomachus in Madagascar and Africa (all specimens with 500 bp). Deep divergences evident between coquereli , troglodytes , and simillimus are evident. Deep divergences within O. coquereli are apparent. The rightmost column of colors differentiate which biogeographical groupings of Wilme et al [29] these populations fall. WCE-1 = Binara. WCE-10 = Manongarivo. WCE-2 = Mahavelona, Kalalao, Betampona, Mananara-Nord, Marojejy, Anjanaharibe. WRDW-a2 = Akirindro, Ambanitaza, Anjanaharibe. doi:10.1371/journal.pone.0001787.g015 Figure 16. Anochetus spp. CO1 DNA barcode heterogeneity. A. grandidieri (n = 113), A. madagascarensis (n = 115), A. goodmani (n = 47), A. boltoni (n = 12) and A. pattersoni (n = 3). doi:10.1371/journal.pone.0001787.g016