A Revision of Malagasy Species of Anochetus Mayr and Odontomachus Latreille
(Hymenoptera: Formicidae)
Brian L. Fisher1*, M. Alex Smith2
1 Department of Entomology, California Academy of Sciences, San Francisco, California,
United States of America
2 Biodiversity Institute of Ontario, University of Guelph, Guelph, Ontario, Canada
*bfisher@calacademy.org
Species inventories are essential for documenting global diversity and generating necessary
material for taxonomic study and conservation planning. However, for inventories to be
immediately relevant, the taxonomic process must reduce the time to describe and identify
specimens. To address these concerns for the inventory of arthropods across the Malagasy
region, we present here a collaborative approach to taxonomy where collectors, morphologists
and DNA barcoders using cytochrome c oxidase 1 (CO1) participate collectively in a team-
driven taxonomic process. We evaluate the role of DNA barcoding as a tool to accelerate species
identification and description.
This revision is primarily based on arthropod surveys throughout the Malagasy region from 1992
to 2006. The revision is based on morphological and CO1 DNA barcode analysis of 500
individuals. In the region, five species of Anochetus (A. boltoni sp. nov., A. goodmani sp. nov.,
A. grandidieri, and A. madagascarensis from Madagascar, and A. pattersoni sp. nov. from
Seychelles) and three species of Odontomachus (O. coquereli, O. troglodytes and O. simillimus)
are recognized. DNA barcoding (using cytochrome c oxidase 1 (CO1)) facilitated caste
association and type designation, and highlighted population structure associated with
reproductive strategy, biogeographic and evolutionary patterns for future exploration.
This study provides an example of collaborative taxonomy, where morphology is combined with
DNA barcoding. We demonstrate that CO1 DNA barcoding is a practical tool that allows
formalized alpha-taxonomy at a speed, detail, precision, and scale unattainable by employing
morphology alone.
Introduction
Anochetus and Odontomachus were treated globally by Brown [1,2]. This paper revises the
genera for the Island of Madagascar and also includes new records from the Seychelles and
Comoro Islands. The revision is based on morphological and CO1 sequence analysis of 500
individuals. We evaluate the role of DNA barcoding as a tool to accelerate species identification
and description.
Anochetus and Odontomachus are closely related genera [1,3,4] characterized by long and
straight mandibles inserted just on either side of the cephalic midline and with two or three large
1
teeth near tip arranged in a vertical series (Figure 1a,b). The single tooth or spine at the apex of
the petiole separates Odontomachus from the closely related genus Anochetus (which has two
teeth or rounded margin). Odontomachus and Anochetus can also be easily distinguished by the
characters on the back of the head. With head viewed from back near neck of pronotum,
Odontomachus has dark, inverted V-shaped apophyseal lines that converge to form a distinct,
sometimes shallow groove or ridge on upper back of head. In Anochetus, the V-shaped
apophyseal lines are absent. In the same region of the back of head, however, nuchal carinae in
Anochetus form an uninterrupted, inverted U-shaped ridge. In the field, small members of
Anochetus might also be mistaken for Strumigenys, from which they may be distinguished by
their one-segmented waist (vs. two segments in Strumigenys).
The utility of a standardized single gene for species recognition (but not phylogenetics) has been
tested in an increasing swath of life. Here we tested how well a cytochrome c oxidase 1 (CO1)
DNA barcode resolved species within Malagasy Anochetus and Odontomachus. In Madagascar,
these ponerine genera are known to include species with independent colony formation by
ergatoid (wingless) queens - and therefore are expected be a challenge for DNA barcoding using
a single mitochondrial marker - but also include cases where prior taxonomy has not linked
males with females and workers, nor has resolved obvious worker dimorphism as either caste
variation or provisional species.
Species level taxonomy in these genera can be quite difficult. Brown [2] noted that males
provide a useful source for species level delimitation. Males, however, are rarely associated with
the worker castes. Brown [2:553] states: "Unfortunately, males found associated in the nest with
the female castes are known only for a minority of the species. Additional kinds of males are
known from collections at light or by Malaise trap, but it has not yet been possible to link any of
these securely to worker-based species."
In this study, we used CO1 barcode sequences to associate worker, queen and male castes. We
conclude that DNA barcoding will enable species delimitation, linking a greater range of the
morphological diversity in ants (castes and sex), and further will provide a set of molecular
characters that improve species delimitation and identification while making these hypotheses
transparent and reproducible.
Methods
This revision is primarily based on arthropod surveys in Madagascar that included over 6,000
leaf litter samples, 4,000 pitfall traps, and 8,000 additional hand collecting events throughout
Madagascar from 1992 through 2006 [5]. Also included are specimens from museums in Genoa,
Geneva, Paris, London, Berlin, Tervuren, and Basel and the extensive collection of Gary D.
Alpert located at the MCZC. Overall, this revision included the study of approximately 1,700
specimens of Anochetus and Odontomachus from 1014 recorded collecting events from
throughout Madagascar with additional samples from Comoros and Seychelles. Roy Snelling
(LACM) provided the records of O. simillimus from his work on the ants of Seychelles. Samples
were selected for CO1 sequencing throughout the geographic range of each species. In total, 501
specimens were sequenced. Specimens examined from Madagascar are listed by increasing
latitude within provinces.
2
All species and type material examined in this study have been imaged and are available on
AntWeb (www.antweb.org). Material was deposited at the California Academy of Sciences, San
Francisco (CASC); British Museum of Natural History, London (BMNH); and Museum of
Comparative Zoology, Harvard University, Cambridge, Massachusetts (MCZC). All sequences,
oligonucleotides and electropherograms are deposited in BOLD (www.barcodinglife.org), and
sequence data has been deposited on Genbank.
In accordance with section 8.6 of the ICZN's International Code of Zoological Nomenclature,
we have deposited copies of this article at the following five publicly accessible libraries:
Natural History Museum, London, UK; American Museum of Natural History, New York, USA;
Museum National d'Histoire Naturelle, Paris, France; Russian Academy of Sciences, Moscow,
Russia; Academia Sinica, Taipei, Taiwan. The three new species names established herein have
been prospectively registered in ZooBank [6-8], the official online registration system for the
ICZN. The ZooBank publication LSID (Life Science Identifier) for the new species described
herein can be viewed through any standard web browser by appending the LSID to the prefix
"http://zoobank.org/".
New specific names in this work are attributive genitive nouns and thus invariant. Each specimen
discussed below is uniquely identified with a specimen-level code (e.g. CASENT0003099)
affixed to each pin. In addition, each specimen may include a collection code, which is a field
number that uniquely identifies collecting events (e.g. BLF01652). Collection codes, when
available, are associated with a collector and follow the collector's name.
Digital color images were created using a JVC KY-F75 digital camera and Syncroscopy Auto-
Montage (v 5.0) software. All measurements were taken at 80x power with a Leica MZ APO
microscope using an orthogonal pair of micrometers, recorded to the nearest 0.001 mm, and
rounded to two decimal places for presentation. When more than one specimen was measured,
minimum and maximum measurements and indices are presented. Measurements follow those
used by Brown [1,2]. Abdominal segments are noted by "A" and the segment number, such as
A2 for the petiole and A3 for the first gastral segment.
Abbreviation used
HL Head length: measured in full-face view; maximum longitudinal length from the
anteriormost portion of the projecting mandible joint (the dorsal socket where the
mandible turns) to the midpoint of a line across the posterior margin. (male: including
ocelli)
HW Head width: Anochetus: maximum width of head; Odontomachus: HW (across upper eye
margin): maximum width of head measured across posterior margin of eyes; HW (across
vertex): maximum width of head measured across temporal prominences. In O. coquereli,
which lacks temporal prominences, the measurement is taken across the part of the vertex
at which the sides are nearly parallel near or a little behind the midlength of the head.
(male: including eyes)
ML Mandible length: The straight-line length of the mandible at full closure, measured in the
same plane for which the HL measurement is taken (full face view), from the mandibular
3
apex to the anterior clypeal margin, or to the transverse line connecting the anterior most
points in those taxa where the margin is concave medially.
EL Eye length: maximum length of eye as measured normally in oblique view of the head to
show full surface of eye.
SL Scape length: maximum chord length excluding basal condyle and neck.
WL Weber's length (Mesosoma length): in lateral view of the mesosoma, diagonal length
from posteroventral corner of propodeum to the farthest point on anterior face of
pronotum, excluding the neck.
PW Pronotum width: in dorsal view, maximum width of pronotum.
FL Femur length: Maximum length of hind femur.
CI Cephalic index: HW/HL x 100.
SI Scape index: SL/HW x 100.
MI Mandible Index: ML/HL x 100
Specimens of Anochetus and Odontomachus were examined from the following collections:
BMNH Natural History Museum, London, U. K.
CASC California Academy of Sciences, San Francisco, CA, USA
LACM Los Angles County Museum, Los Angeles, CA, USA
MCZC Museum of Comparative Zoology, Harvard University, Cambridge, MA, USA
MHNG Muséum d'Histoire Naturelle, Geneva, Switzerland
MNHN Muséum National d'Histoire Naturelle, Paris, France
MRAC Musée Royal de l'Afrique Centrale, Tervuren, Belgium
MSNG Museo Civico de Historia Natural "Giacomo Doria", Genoa, Italy
NHMB Naturhistorisches Museum, Basel, Switzerland
PSWC P. S. Ward Collection, University of California at Davis, CA, USA
CO1 methods
Specimens were preserved in 95% ethanol in Madagascar and upon return to California were
loaded into ScrewTop TrakMates® boxes (Matrix Technologies) and shipped to the University
of Guelph. There, DNA was extracted from tissues rich in mitochondria (e.g. legs), employing
primers with high universality, and amplifying a PCR product approximately 600 bp in length.
Total genomic DNA extracts were prepared from small pieces (<1mm) of tissue using the
NucleoSpin® 96 Tissue kit (Macherey-Nagel Duren, Germany), following the manufacturer's
protocols. Extracts were resuspended in 30 ul of dH2O, and a 650base-pair (bp) region near the
5' terminus of the CO1 gene was amplified following standard protocol [9]. Briefly, full length
sequences were amplified using primers (LF1-ATTCAACCAATCATAAAGATATTGG and
LR1-TGATTTTTTGGACATCCAGAAGTTTA [10]). In cases where a 650 bp product was not
successfully generated, internal primer pairs (LF1-ANTMR1-(see Table 1)) and (MLF1 -
GCTTTCCCACGAATAAATAATA [11] - LR) were employed to generate shorter overlapping
sequences that allowed the creation of a composite sequence (contig). PCR reactions were
carried out in 96 well plates in 12.5 ul reaction volumes containing: 2.5 mM MgCl2, 5 pmol of
each primer, 20 uM dNTPs, 10 mM Tris HCl (pH 8.3), 50 mM KCl, 10-20 ng (1-2 ul) of
genomic DNA, and 1 unit of TaqDNA polymerase (Platinum® Taq DNA Polymerase -
Invitrogen) using a thermocycling profile of one cycle of 2 min at 94°C, five cycles of 40 sec at
94°C, 40 sec at 45°C, and 1 min at 72°C, followed by 36 cycles of 40 sec at 94°C, 40 sec at
4
51°C, and 1 min at 72°C, with a final step of 5 min at 72°C. Products were visualized on a 2%
agarose E-Gel® 96-well system (Invitrogen) and samples containing clean single bands were
bidirectionally sequenced using BigDye v3.1 on an ABI 3730xl DNA Analyzer (Applied
Biosystems). Contigs were made using Sequencher v4.0.5 (Gene Codes) and were subsequently
aligned by eye in Bioedit [12]. Sequence divergences were calculated using the K2P distance
model [13] and a NJ tree of distances [14] was created to provide a graphic representation of the
patterning among-species divergences using MEGA3 [15], and BOLD [16]. Sequence neutrality
[Tajima's D - 17] and rates of substitution were calculated with DnaSP v.3 [18]. Sequences and
other specimen information are available in the project file "Revision of Malagasy Anochetus
and Odontomachus" in the Published Projects section of the Barcode of Life website
(www.barcodinglife.org) with complete collection information for each specimen deposited at
www.antweb.org. All sequences from the barcode region have been deposited in Genebank
(CO1: EF610629: EF611041, EF999925-EF999945).
A composite representation of variation within the CO1 DNA barcode for each of the eight
species revised here is presented in Figures 15 and 16. We used the online program Fingerprint
[19 - http://evol.mcmaster.ca/fingerprint] to illustrate the heterogeneity at a specific site within
the barcode region as a percentage of the vertical line drawn to represent each base pair.
Diagnostic base pairs (or combination of base pairs) for each species within the Malagasy region
are presented. This more cladistic interpretation of the DNA barcode data is very sensitive to the
number of specimens analyzed - and the fewer specimens incorporated, the greater the
likelihood that a rare haplotype is not reflected in the data. We present this method of analysis
not to that our coverage of each species is sufficient to reflect the variation within a species, but
rather to demonstrate that such an analysis is possible within a group of taxa or region, when
there is good representation of the variability within a species. The nucleotide position given
refers to the barcode region, and can be compared to their full mitochondrial position by adding
48 (as aligned to the Bos taurus complete mitochondrial genome sequence Genbank ref
AY676873). The standard IUPAC ambiguity codes are used to denote intra-specific variation.
Complementary genetic analyses. In addition to the CO1 barcode, for some specimens we
amplified portions of the rRNA gene regions: 18S, 28S (D2) and ITS1. Within the variable D2
region of 28S, the forward primer corresponds to positions 3549-3568 in Drosophila
melanogaster reference sequence (Genbank M21017). Within the 18S sequence, the forward
primer corresponds to positions 375-406 in Drosophila melanogaster reference sequence while
the ITS1 sequence was generated using primers where the forward primer corresponds to
positions 1822-1843 in Drosophila melanogaster reference sequence. Representative sequences
have been deposited in Genbank: 18S: EU041960-EU042009; 28S: EU042010-EU042038,
EU073708:EU073711; ITS1: EU042039-EU042097, EU073664: EU073707). Primers used to
generate these fragments are listed in Table 1. In some cases we utilized a standard PCR
diagnostic to test for Wolbachia [20]. Wolbachia are obligate intracellular endosymbiotic
bacteria that cause reproductive incompatibility between infected and uninfected lineages,
resulting in an increased proportion of infected maternal lineages that cannot reproduce.
5
Results
Taxonomic synopsis
Check-List of Malagasy Anochetus Species
boltoni sp. nov.
goodmani sp. nov.
grandidieri Forel, 1891
= madecassus Santschi, 1928
madagascarensis Forel, 1887
= africanus var. friederichsi Forel, 1918
pattersoni sp. nov.
Key to workers and queens of Malagasy Anochetus.
1 Inner mandibular blade without preapical teeth and denticles (Figs 3a, 4a).............................2
Inner mandibular blade with at least four preapical teeth and denticles (Figs 2a,e)..................4
2 Worker compound eye large, > 0.15 mm long. In full face view, antennal scape extends
beyond posterior margins of occipital lobe. Dorsal surface of head and mesosoma with or
without numerous short setae................................................................................................. 3
Worker compound eyes small, < 0.15 mm long. In full face view, antennal scape usually fail
to reach, and never surpass, posterior margin of occipital lobe. Dorsal surface of head with
numerous short setae (Fig. 3a)..............................................................................grandidieri
3 Dorsal surface of head and mesosoma without numerous short setae (Fig. 3a). Pronotal
dorsum glassy smooth................................................................................madagascarensis
Dorsal surface of head and mesosoma with numerous short setae (Figs 7a,b). Pronotal
dorsum with punctures anteriorly and longitudinal ridges posteriorly (Aldabra).pattersoni
4 Petiolar node as seen from front or rear with apical margin deeply concave, lateral corner
forming long spine (Fig. Figure 5a)..............................................................................boltoni
Petiolar node as seen from front or rear with apical margin rounded, or slightly flattened, the
lateral corner without spine (Fig. 5b)...................................................................... goodmani
Key to males of Malagasy Anochetus (males of goodmani unknown and not included)
1 Shortest distance between lateral ocellus and margin of compound eye smaller than
maximum length of ocellus. Petiolar node as seen from front or rear with lateral corners
rounded, without acute spine or sharp tooth .......................................................................... 2
Shortest distance between lateral ocellus and margin of compound eye distinctly greater than
maximum length of ocellus. Petiolar node as seen from front or rear with lateral corners
with acute spine or tooth ........................................................................................................ 3
2 Body yellowish brown. Petiolar node as seen from front or rear with apical margin concave.
Paramere simple with rounded apex (Fig. 8c).............................................madagascarensis
Body dark brown, black. Petiolar node as seen from front or rear with apical margin more or
less flat. Paramere constricted apically into a ventrally-directed digitiform lobe (Fig. 8d)
.................................................................................................................................pattersoni
3 Head and mesoscutum with dense reticulate sculpture, opaque, not smooth or shiny.
Declivitous surface of propodeum abrupt, about as long as dorsal surface..........grandidieri
6
Head and mesoscutum with week sculpture, smooth and shiny areas present. Declivitous
surface of propodeum gradually sloping posteriorly, indistinctly delimited from dorsal
surface..........................................................................................................................boltoni
Anochetus boltoni Fisher sp. nov.
urn:lsid:zoobank.org:act:B6C072CF-1CA6-40C7-8396-534E91EF7FBB
Figures: worker 2a,b, 5a; male 2c,d, 8a; map 6a
Type Material: Holotype worker, MADAGASCAR: Antsiranana, Parc National de Marojejy,
Manantenina River, 28.0 km 38° NE Andapa, 8.2 km 333° NNW Manantenina, 14°26'12"S,
049°46'30"E, 450 m, sifted litter, rainforest, 12-15 Nov 2003 (coll. B. L. Fisher et al.), comma
collection code: BLF08985 pin code: CASENT0104542 (CASC). Paratype. 8 workers with
same data as holotype but pins coded, CASENT0487895, CASENT0487896, CASENT0487897,
CASENT0006943. (BMNH, MCZ, CAS); CO1 Barcode from paratype collection and coded
CASENT0487895-D01
Worker measurements: maximum and minimum based on all specimens, n=20, (holotype): HL
1.80-2.08 (1.95), HW 1.61-1.89 (1.71), CI 87-98 (88), EL 0.33-0.41 (0.36), ML 1.15-1.25 (1.20),
MI 59-66 (61), SL 1.83-1.96 (1.84) SI 101-115 (107), WL 2.63-2.89 (2.73), FL 1.97-2.13 (2.03),
PW 0.95-1.06 (1.00).
Male measurements: maximum and minimum based on n=2 from Madagascar: HL 0.89-0.91,
HW 1.05-1.13, CI 118-125, EL 0.56-0.62, SL 0.24, SI 21-23, WL 2.20-2.24, FL 1.75-1.80
Worker Diagnosis: Blade of mandible with five teeth and denticles located along distal two
thirds of blade's length. Propodeum with short teeth (Fig. 5a). Dorsolateral margin of petiole
with long spine (Fig. 5a). In frontal view, petiolar margin deeply U-shaped. Pilosity, sculpture as
in Figures 2a,b.
Male caste: Dorsolateral margin of petiole with acute spine.
The species is most similar to A. goodmani, but can be easily distinguished by its petiole node
with a pair of large apical spines.
Distribution and biology. The distribution is limited to collections made between 450m and
750m in rainforest in Parc National de Marojejy and 240 m from Ambanitaza near Antalaha (Fig.
4a). It has been collected three times in rotten logs and once in a leaf litter sample. Males have
been collected in malaise samples on 20-25 Dec 2004 at 488 m in Parc National de Marojejy
CO1. The two populations where collections have been made to date are characterized by a deep
divergence within the DNA barcode region (Maximum - 8%) (Fig. 15).
Diagnostic barcoding loci. A. boltoni: ATCT-42-45 & RTTAR-66-70
Discussion: Specimens from Ambanitaza differ notably in shape of propodeal spines and length
of spines on petiole from those of the type locality. Though these localities are quite close (40
7
km apart), these character differences are noticeable, and correspond to significant differences in
CO1 (34 base pairs) and ITS1. While specimens from each location were invariant within 18S,
there is a 7 bp insertion within ITS1 that is characteristic of the Ambanitaza population which is
missing from all specimens from Marojejy. Ultimately, more collections need to be made and
evaluated in order to test the hypothesis that these populations represent separate species. One
important factor to consider in the testing of that hypothesis is reproductive strategy, which is, to
our knowledge, through fission. Though the queen caste is not known, based on overall
similarity of workers with A. goodmarii, it is likely that the queen of boltoni is wingless. Queens
have never been collected during the 12 month malaise trap sampling even though males were
collected. Species that reproduce by fission may show greater geographic differences in
morphology and CO1.
Additional material examined for Anochetus boltoni: In addition to the type material,
specimens from 4 additional collecting events from the following three localities were examined
in this study. MADAGASCAR: Province Antsiranana: Parc National de Marojejy, Manantenina River, 27.6 km
35° NE Andapa; Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa; Forêt Ambanitaza, 26.1
km 347° Antalaha. This material shows greater variation in number of denticles along blade of mandible, ranging
from 5-7, compared to the paratypic material.
Anochetus goodmani Fisher sp. nov.
urn:lsid:zoobank.org:act:C7D27B95-E1F0-41AC-968C-76BCF3886010
Figures: worker 2e,f; queen 2g,h; map 6a
Type Material: Holotype worker, MADAGASCAR, Forêt de Binara, 7.5 km 230° SW Daraina,
13°15'18"S, 049°37'00"E, 375 m, 1-4 Dec 2003 (coll. B. L. Fisher et al.), collection code:
BLF09638, pin code: CASENT0498309 (CAS). Paratypes: 8 workers with same data as
holotype but pins coded, CASENT104548, CASENT0498310, CASENT0498311,
CASENT0006944, CASENT0006945 (BMNH, MCZ, CAS); CO1 Barcode from paratype
collection and coded CASENT0498310-D01.
Worker measurements: maximum and minimum based on all specimens, n=15, (holotype): HL
1.77-2.01 (1.92), HW 1.55-1.81 (1.77), CI 86-92 (92), EL 0.35-0.43 (0.42), ML 1.04-1.15 (1.11),
MI 56-66 (58), SL 1.68-1.97 (1.79) SI 101-109 (101), WL 2.52-2.89 (2.66), FL 1.85-2.17 (2.03),
PW 0.92-1.06 (1.01).
Queen (ergatoid) measurements: maximum and minimum based on n=5. HL 1.62-1.79, HW
1.49-1.65, CI 91-93, EL 0.37-0.41, ML 0.92-1.02, MI 55-59, SL 1.56-1.71, SI 99-106, WL 2.33-
2.55, FL 1.77-1.91, PW 0.88-0.99.
Worker Diagnosis: Blade of mandible with five teeth and denticles located at the distal half of
the blade length. Petiole dorsal margin without spines. In front view, the dorsal petiolar margin
flat with lateral margin rounded (Fig. 6b). Pilosity, sculpture as in Figures 2e,f.
The species is most similar to A. boltoni but can be easily distinguished by its petiole node
without apical spines.
8
No winged queens are known. Ergatoid queens were collected at six localities. In four of the
collections, three ergatoid queens were collected in the same locality. They are very similar in
size and shape to workers (Figs 2g,h), and have no ocelli (Fig. 2g). Males are not known.
Distribution and biology. A. goodmani is endemic to Madagascar and is widespread in northern
and western parts of the island. It has been collected in dry forest and rainforest as low as 30 m
in altitude and also in montane rainforest at the altitude 960 m on Montagne d'Ambre (Fig. 6a),
most frequently under stones (12 collections) and sifted litter (7), but also at light (1), beating
low vegetation (3), rot pocket (1), in rotten log (6), ground foragers (1), ground nest (9), Malaise
trap (1), on low vegetation (1), and pitfall traps (4).
CO1. Average intraspecific sequence divergence of 6.37%. There is strong geographic
coherence in the divergence patterns (Figs 9, 15, Table 2) with deep divergences occurring
between separate regions isolated by habitat and mountains.
Diagnostic barcoding loci. A. goodmani: Y-231 (madagascarensis and grandidieri A; boltoni
and pattersoni T), W-233 (all others A), RWR-368-370 (others are all ATG), Y-541 (others are
all T), R-543 (others are all A), W-546 (others are all T), W-585 (others are all T), M-634 (others
are all C). RWCW-42-45 & WTTAG-66-70 (this distinguishes goodmani from all (including
boltoni) except some madagascarensis), & GT-83-84 (madagascarensis is TA).
Discussion. Anochetus goodmani is characterized by extreme divergence within the barcode
region. To date, sequencing complementary nuclear markers has provided some degree of
support for the deepest CO1 divergences (between the north and south-west of Madagascar) as
being separate species. Importantly however, ITS1 sequences as divergent have been produced
from the same individual (Appendix S1 and Table 3). Although CO1 supports more than one
operational unit within A. goodmani the hypothesis of cryptic species in relatively isolated
environments requires further evidence with less ambiguity.
Additional material examined for Anochetus goodmani: In addition to the type material,
specimens from 56 additional collecting events from the following 18 localities were examined
in this study. MADAGASCAR: Province Antsiranana: Montagne des Français, 7.2 km 142° SE Antsiranana;
Parc National Montagne d'Ambre; Réserve Spéciale de l'Ankarana, 13.6 km 192° SSW Anivorano Nord; Réserve
Spéciale de l'Ankarana, 22.9 km 224° SW Anivorano Nord; Forêt d'Ampondrabe, 26.3km 10° NNE Daraina; Forêt
d' Andavakoera, 21.4km 75° ENE Ambilobe; 4.6km 356° N Betsiaka; Forêt d' Antsahabe, 11.4km 275° W Daraina;
Forêt de Binara, 7.5 km 230° SW Daraina; Ampasindava, Forêt d'Ambilanivy, 3.9 km 181° S Ambaliha; Forêt
d'Anabohazo, 21.6 km 247° WSW Maromandia; Réserve Spéciale de Bemarivo, 23.8 km 223° SW Besalampy; Parc
National Tsingy de Bemaraha, 10.6 km ESE 123° Antsalova; Parc National Tsingy de Bemaraha, 2.5 km 62° ENE
Bekopaka, Ankidrodroa River; Parc National Tsingy de Bemaraha, 3.4 km 93° E Bekopaka, Tombeau Vazimba.
Province Toliara: Parc National de Kirindy Mite, 16.3 km 127° SE Belo sur Mer..
Anochetus grandidieri Forel
Figures: worker 3a-d, 5c; queen 3e-h; male 3i-j, 8b; map 6b
Type material:
Anochetus grandidieri Forel, 1891: 108 [21]. Lectotype: worker, Madagascar, Forest of the east
coast (M. Humblot) (MHNG), present designation [examined], AntWeb CASENT0101819.
Brown, 1978: 606 [2] (description of worker).
9
Anochetus madecassus Santschi, 1928: 54 [22]. Lectotype: dealate queen, Madagascar, Nossi-Be
(Descarpentries) (NHMB) Lectotype by present designation [examined] AntWeb
CASENT0101098. Synonymized with grandidieri by Brown, 1978: 557 [2].
Worker measurements: maximum and minimum based on all specimens, n=20. HL 0.79-1.19,
HW 0.71-1.06, CI 85-95, EL 0.08-0.13, ML 0.33-0.57, MI 41-54, SL 0.57-0.88, SI 78-86, WL
0.87-1.35, FL 0.57-0.90, PW 0.44-0.62.
Queen measurements: maximum and minimum based on n=5. HL 0.88-1.15, HW 0.81-1.07, CI
92-96, EL 0.17-0.23, ML 0.39-0.56, MI 44-49, SL 0.62-0.87, SI 77-81, WL 1.08-1.46. FL 0.68-
0.96, PW 0.60-0.78.
Male measurements: maximum and minimum based on n=5 from Madagascar: HL 0.58-0.73,
HW 0.78-0.94, CI 129-135, EL 0.37-0.46, SL 0.10-0.15, SI 13-16, WL 1.17-1.52, FL 0.78-1.08
Worker diagnosis. Inner blade of mandible without teeth and denticles; apical end of inner
blade without a notched semicircular concavity (Fig. 2a). Eyes small (0.05-0.11 mm), projecting
dorsolaterally. In full face view, antennal scape usually not reaching, and not surpassing
posterior margin of occipital lobe. Dorsal surface of head with numerous short setae. Pilosity and
sculpture as in Figures 3Figure a-d.
Queens alate. Very similar to workers, only slightly larger than respective size class (Figs 3e-h).
Ergatoid queens not recorded.
Within a single locality, two size classes of workers, queens and males are present in this
species, but the differences within a site do not hold up when variation across all sites is
included. These differences suggest that two reproductive and developmental pathways can
occur in this species. Further work is needed to explore the biotic or abiotic factors that trigger
the development of small and large castes.
The species is most similar to A. madagascarensis but can be easily distinguished by its small
eyes and scape that does not surpass the occipital lobe. A. madagascarensis has large eyes (0.24-
0.26 mm), and scapes that surpass occipital lobes.
Distribution and biology. A. grandidieri is endemic to Madagascar and is widespread
throughout Madagascar in forest and shrubland habitats below 1,550m elevation (Fig 4b). It has
been collected in gallery, dry, littoral, lowland, and montane forest, in desert spiny bush thicket
in the southwest, and Uapaca woodland in the central plateau. As in many soil dwelling ants, A.
grandidieri has reduced eyes (EL/HW 0.11-0.13) and short scapes. A. grandidieri is the only
Anochetus in Madagascar with these soil nesting modifications. The subterranean habitat of this
species may allow it to survive in a wide range of habitats in Madagascar from desert to
woodland to montane forest. Out of 453 collecting events, A. grandidieri was most often
recorded in sifted litter (97 collection records), rotten logs (96), and Malaise traps (155).
10
CO1. Shallow intraspecific (average within species sequence divergence of 2.72, SE = 0.048)
and deep interspecific divergences (9.4 % SE = 0.05) between A. grandidieri and the other
species. Small and large castes had identical DNA barcodes. (Figs 9, 16).
Diagnostic barcoding loci. A grandidieri: T-273, T-282, T-306, A-312, (shared with one
population of A. goodmani), A-312, T-333, A-483, T-528 (all 3rd base pair positions).
Specimens examined for Anochetus grandidieri: Specimens from 456 separate collection events
from the following 140 localities were examined. MADAGASCAR: Province Antsiranana: Sakalava Beach ;
Montagne des Français, 7.2 km 142° SE Antsiranana ; Antsiranana II Pref: Antsahampano S.-Pref: Montagne
d'Ambre. Site MD2; Parc National Montagne d'Ambre, 3.6 km 235° SW Joffreville; Réserve Spéciale de
l'Ankarana, 13.6 km 192° SSW Anivorano Nord; Forêt d'Ampondrabe, 26.3km 10° NNE Daraina; Forêt d'
Antsahabe, 11.4km 275° W Daraina; Forêt de Binara, 7.5 km 230° SW Daraina; Forêt de Binara, 9.1km 233° SW
Daraina; Nosy Be, Lokobe Forest; Forêt Ambato, 26.6 km 33° Ambanja; Ambondrobe, 41.1km 175° Vohemar;
Ampasindava, Forêt d'Ambilanivy, 3.9 km 181° S Ambaliha; R.S. Manongarivo, 10.8 km 229° SW Antanambao;
R.S. Manongarivo, 12.8 km 228° SW Antanambao; R.S. Manongarivo, 14.5 km 220° SW Antanambao; Forêt
d'Anabohazo, 21.6 km 247° WSW Maromandia; Parc National de Marojejy, Manantenina River, 27.6 km 35° NE
Andapa, 9.6 km 327° NNW Manantenina; Parc National de Marojejy, Manantenina River, 28.0 km 38° NE Andapa,
8.2 km 333° NNW Manantenina; Parc National Marojejy; Marojejy R.N.I. #12; Forêt Ambanitaza, 26.1 km 347°
Antalaha; 9.2 km WSW Befingotra, Rés. Anjanaharibe-Sud; 6.5 km SSW Befingotra, Rés. Anjanaharibe-Sud; 17km
W Andapa, Res. d' Anjanaharibe-Sud; 5 km SW Antalaha; 14km W Cap Est, Ambato; Fotodriana, Cap Masoala.
Province Mahajanga: Mahavavy River, 6.2 km 145° SE Mitsinjo; Réserve d'Ankoririka, 10.6 km 13° NE de
Tsaramandroso; Ampijoroa National Park, 160 km N Maevatanana, Mahajanga Prov., deciduous forest; Parc
National de Namoroka, 17.8 km 329° WNW Vilanandro; Parc National de Namoroka, 16.9 km 317° NW
Vilanandro; Parc National de Namoroka, 9.8 km 300° WNW Vilanandro; Réserve Spéciale de Bemarivo, 23.8 km
223° SW Besalampy; Parc National Tsingy de Bemaraha, 10.6 km ESE 123° Antsalova; Forêt de Tsimembo, 8.7 km
336° NNW Soatana; Parc National Tsingy de Bemaraha, 2.5 km 62° ENE Bekopaka, Ankidrodroa River; Parc
National Tsingy de Bemaraha, 3.4 km 93° E Bekopaka, Tombeau Vazimba; Province Toamasina: Montagne
d'Anjanaharibe, 19.5 km 27° NNE Ambinanitelo; Montagne d'Anjanaharibe, 18.0 km 21° NNE Ambinanitelo;
Montagne d'Akirindro 7.6 km 341° NNW Ambinanitelo; 19km ESE Maroantsetra; 6.9 km NE Ambanizana,
Ambohitsitondroina; Ambanizana, Parc National Masoala; 5.3 km SSE Ambanizana, Andranobe; 6.3 km S
Ambanizana, Andranobe; 1km W Andampibe, Cap Masoala; Parc National Mananara-Nord, 7.1 km 261°
Antanambe; Forêt d'Analava Mandrisy, 5.9 km 195° Antanambe; Res. Ambodiriana, 4.8 km 306°Manompana, along
Manompana River; Ile Sainte Marie, Forêt Ambohidena, 22.8 km 44° Ambodifotatra; Ile Sainte Marie, Forêt
Kalalao, 9.9 km 34° Ambodifotatra; Parcelle E3 Tampolo; S.F. Tampolo, 10 km NNE Fenoarivo Atn.; Bridge at
Onibi, NW of Mahavelona; Mahavelona (Foulpointe); 2.1 km 315° Mahavelona; Foulpointe; Reserve Betampona,
Camp Vohitsivalana, 37.1 km 338° Toamasina; Reserve Betampona, Camp Rendrirendry 34.1 km 332° Toamasina;
F.C. Sandranantitra; F.C. Didy; F.C. Andriantantely; P.N. Mantadia; Analamay; Forêt Ambatovy, 14.3 km 57°
Moramanga; Torotorofotsy; Andasibe National Park, botanic garden near entrance, West of ANGAP office; Res.
Analamazaotra, Parc National, Andasibe; Fianarantsoa: Forêt d'Atsirakambiaty, 7.6 km 285° WNW Itremo;
Ranomafana Nat. Park, Miaranony Forest; Vohiparara broken bridge, Fianarantsoa Prov.; Parc National de
Ranomafana, Sahamalaotra River, 6.6 km 310° NW Ranomafana; Parc Nationale Ranomafana: Talatakely; 3 km W
Ranomafana, nr. Ifandiana; research cabin at Talatakely, Ranomafana National Park; radio tower, Ranomafana
National Park, Fianarantsoa Prov.; Namorona River at footbridge, Ranomafana National Park; Ranomafana National
Park, Tavolo tree; Belle Vue trail, Ranomafana National Park, Fianarantsoa Prov.; 7 km W Ranomafana;
Vatoharanana; Parc National de Ranomafana, Vatoharanana River, 4.1 km 231° SW Ranomafana; P.N.
Ranomafana, Vatoharanana-Ankovoka; 8km E Kianjavato, Vatovavy Forest; 7.6 km 122° Kianjavato, Forêt Classée
Vatovavy; 2km W Andrambovato, along river Tatamaly; Forêt d'Ambalagoavy Nord, Ikongo, Ambatombe; 45km S.
Ambalavao; 45 km S Ambalavao; 43 km S Ambalavao, Rés. Andringitra; Parc National d'Isalo, Ambovo Springs,
29.3 km 4° N Ranohira; 8.0 km NE Ivohibe; 9.0 km NE Ivohibe; R.S. Ivohibe, 7.5 km ENE Ivohibe; Parc National
d'Isalo, 9.1 km 354° N Ranohira; Forêt d'Analalava, 29.6 km 280° W Ranohira; Forêt de Vevembe, 66.6 km 293°
Farafangana; Province Toliara: Réserve Spéciale d'Ambohijanahary, Forêt d'Ankazotsihitafototra, 34.6 km 314°
NW Ambaravaranala; Réserve Spéciale d'Ambohijanahary, Forêt d'Ankazotsihitafototra, 35.2 km 312° NW
Ambaravaranala; Vohibasia Forest, 59 km NE Sakaraha; southern Isoky-Vohimena Forest, 59 km NE Sakaraha;
11
Forêt Classée d'Analavelona, 33.2 km 344° NNW Mahaboboka; Forêt Classée d'Analavelona, 29.2 km 343° NNW
Mahaboboka; Forêt Classée d'Analavelona, 29.4 km 343° NNW Mahaboboka; Forêt de Tsinjoriaky, 6.2 km 84° E
Tsifota; Parc National de Zombitse, 19.8 km 84° E Sakaraha; Parc National de Zombitse, 17.7 km 98° E Sakaraha;
15 km E Sakaraha; Forêt de Mite, 20.7 km 29° WNW Tongobory; Sept Lacs; Beza-Mahafaly, 27 km E Betioky;
Ehazoara Canyon, 26 km E Betioky; 70.7 km NNE Tolanaro, Mahermano Mt.; 11 km NW Enakara, Rés.
Andohahela; 10 km NW Enakara, Rés. Andohahela; Rés. Andohahela, 6 km SSW Eminiminy; Parc National
d'Andohahela, Col du Sedro, 3.8 km 113° ESE Mahamavo, 37.6 km 341° NNW Tolagnaro; Parc National
d'Andohahela, Manampanihy River, 5.4 km 113° ESE Mahamavo, 36.7 km 343° NNW Tolagnaro; 2.7 km WNW
302° Ste. Luce; 9.2 km N Tolanaro, Ilapany Mt.; 29.5 km WNW Tolanaro, Vasiha Mt.; Parc National d'Andohahela,
Forêt d'Ambohibory, 1.7 km 61° ENE Tsimelahy, 36.1 km 308° NW Tolagnaro; Mandena, 8.4 km NNE 30°
Tolagnaro; Réserve Privé Berenty, Forêt de Bealoka, Mandraré River, 14.6 km 329° NNW Amboasary; Réserve
Privé Berenty, Forêt de Malaza, Mandraré River, 8.6 km 314° NW Amboasary; Réserve Berenty; Forêt de Petriky,
12.5 km W 272° Tolagnaro; 4.4 km 148° SSE Lavanono; Réserve Spéciale de Cap Sainte Marie, 14.9 km 261° W
Marovato; near road, Zombitse National Park, Tulear Prov.; near ANGAP office, Zombitse National Park, Tulear
Prov.; Parcel I, Beza Mahafaly Reserve, near research station, Tulear Province; Tsimelahy - Parcel II, Andohahela
National Park, transition forest, Tulear Province.
Anochetus madagascarensis Forel
Figures: worker 1a, 4a,b, 5d; queen 4c,d; male 4e,f, 8b; map 6c
Type material:
Anochetus africanus madagascarensis Forel, 1887: 382 [23]. Lectotype: worker, Madagascar,
Tamatave Province, Ivondro, (Dr. Conrad Keller) (MHNG) present designation [examined]
AntWeb CASENT0101574. Raised to species by Brown, 1978: 557 [2].
Anochetus africanus friederichsi Forel 1918: 155 [24]. Lectotype: worker, Madagascar,
Tamatave Province, Prune Island (Nosy Alanana) (Friederichs) (MHNG), present
designation [examined] AntWeb CASENT010165. Synonymized with madagascarensis by
Brown, 1978: 557 [2].
Worker measurements: maximum and minimum based on n=20. HL 1.35-1.68, HW 1.19-1.53,
CI 87-94, EL 0.23-0.28, ML 0.73-0.93, MI 53-57, SL 1.11-1.41, SI 89-95, WL 1.60-2.02, FL
1.13-1.54, PW 0.63-0.80.
Queen measurements: maximum and minimum based on n=5. HL 1.52-1.66, HW 1.48-1.55, CI
92-97, EL 0.32-0.36, ML 0.81-0.89, MI 53-55, SL 1.26-1.39, SI 85-91, WL 1.99-2.22. FL 1.35-
1.49, PW 0.84-0.92.
Male measurements: maximum and minimum based on n=5 from Madagascar: HL 0.85-1.89,
HW 1.07-1.20, CI 122-135, EL 0.63-0.69, SL 0.20-0.22, SI 18-21, WL 1.90-1.98, FL 1.35-1.47
Worker Diagnosis: Inner blade of mandible without teeth and denticles; apical end of inner
blade with notched semicircular concavity (Fig. 1a). Eyes large (0.24-0.26 mm), projecting
dorsally. In full face view, antennal scape extends beyond posterior margin of occipital lobe.
Dorsal surface of head asetose. Pilosity and sculpture as in Figures 4a,b.
Queens alate: Very similar to worker and only slightly larger (Figs 4c,d). Queens of only one
size. Ergatoid queens not recorded.
12
Males: Males light yellowish brown in color and with large projecting ocelli on vertex (Figs
4e,f). Males have been collected in Malaise traps in every month of the year and males have
been noted to swarm and fly at dusk and early evening.
The species is most similar to A. grandidieri but can be easily distinguished by its large eyes
(0.24-0.26 mm), and scapes that surpass occipital lobes.
Distribution and biology. A. madagascarensis is widespread throughout Madagascar in forest
or shrubland habitats below 1100m elevation and is also known from the Comoros. Forel's
(1912:159) record of a male "Anochetus sp.? africanus var. madagascariensis Forel" from
Seychelles, Mahé, has not been seen and confirmed. This record most likely refers to pattersoni.
In Madagascar, madagascarensis is widespread and has been collected in gallery, dry, littoral,
lowland, and montane forests, and in desert spiny bush thicket in the southwest of Madagascar.
The longer scapes and larger eyes of A. madagascarensis compared to A. grandidieri, correlate
with nesting and foraging above the soil layer. The species was most often recorded nesting in
rotten logs (99 collection records) followed by sifted litter (41). In addition, it was collected
from dead twigs above ground (1), rot pockets (2), ground foragers (20), ground nests (6),
Malaise trap (14), on low vegetation (2), and pitfall traps (4).
CO1. Shallow intraspecific and deep interspecific divergences between A. madagascarensis and
the other species. Average within species sequence divergence of 1.67% (SE = 0.055) (Fig. 16).
Diagnostic barcoding loci. A. madagascarensis: A-21, T-423 (shared with one A. goodmani
population), T-132 (shared with one A. grandidieri population), T-83, A-84, T-93, T, 138, C-
306, T-513, A-595
Specimens examined for Anochetus madagascarensis:
Specimens from 326 separate collection events from the following 129 localities were examined.
COMORES: Mayotte Island: Majimbini; Coconi DAF campus; Poroani; Riv. Kouale nr. Caserne; Convalescence;
Dziani Karihani; Tsingoni; Mt. Choungui; Mt. Combani; Coconi, SDA (service du develppement agricole); Mt.
Benara; Sazile; MADAGASCAR: Antsiranana: Nosy Be 5km SE Marodokana; ridge behind Sambava, Q-37;
Antalaha 18 km North; Nossi bé;; 68km SW of Sambava; Ambohitsara, 10km SW Antalaha; 2km W Antalaha;
Soavinandriana; 2km S Antalaha; Orangea, 3 km E Ramena [near fort]; Forêt d'Orangea, 3.6 km 128° SE Remena;
Sakalava Beach; 1 km W Sakalava Beach; 3 km W Sakalava Beach; Montagne des Français, 7.2 km 142° SE
Antsiranana; Montaigne Francais; 7 km N Joffreville; Réserve Spéciale d'Ambre, 3.5 km 235° SW Sakaramy; Parc
National Montagne d'Ambre; Parc National Montagne d'Ambre; Parc National Montagne d'Ambre [Petit Lac road];
Parc National Montagne d'Ambre, 3.6 km 235° SW Joffreville; Rés. Analamerana, 16.7 km 123° Anivorano-Nord;
Réserve Spéciale de l'Ankarana, 13.6 km 192° SSW Anivorano Nord; Ankarana; Res. Ankarana; Réserve Spéciale
de l'Ankarana, 22.9 km 224° SW Anivorano Nord; Forêt d'Ampondrabe, 26.3km 10° NNE Daraina; Forêt
d'Analabe, 30.0 km 72° ENE Daraina; Forêt d' Andavakoera, 21.4km 75° ENE Ambilobe; 4.6km 356° N Betsiaka;
Forêt de Bekaraoka, 6.8km 60° ENE Daraina; Forêt d' Antsahabe, 11.4km 275° W Daraina; Forêt de Binara, 7.5 km
230° SW Daraina; Forêt de Binara, 9.1km 233° SW Daraina; Nosy Be, Airport; Nosy Be, 5km Marodokana; Nosy
be, Ambatoloaka; Nosy Be, Lokobe Forest; Nosy Be, 4 km ESE Andoany (=Hellville); Nosy Be, Réserve Naturelle
Intégrale de Lokobe, 6.3 km 112° ESE Hellville; Forêt Ambato, 26.6 km 33° Ambanja; Ambondrobe, 41.1km 175°
Vohemar; Ampasindava, Forêt d'Ambilanivy, 3.9 km 181° S Ambaliha; R.S. Manongarivo, 10.8 km 229° SW
Antanambao; R.S. Manongarivo, 12.8 km 228° SW Antanambao; Forêt d'Anabohazo, 21.6 km 247° WSW
Maromandia; Forêt Ambohibato, 27.2 km 349° Antalaha; Forêt Ambanitaza, 26.1 km 347° Antalaha; 18km N
Antalaha, Ampahana; 5km S + 5km W Antalaha; Antalaha, 12km S; Marofinaritra; 14km W Cap Est, Ambato;
Mahajanga: Forêt Ambohimanga, 26.1 km 314° Mampikony; Parc National d'Ankarafantsika, Forêt de Tsimaloto,
18.3 km 46° NE de Tsaramandroso; Ampijoroa National Park, 160 km N Maevatanana, Mahajanga Prov., deciduous
13
forest; Parc National de Namoroka, 16.9 km 317° NW Vilanandro; Parc National de Namoroka, 9.8 km 300° WNW
Vilanandro; Réserve Spéciale de Bemarivo, 23.8 km 223° SW Besalampy; Parc National Tsingy de Bemaraha, 2.5
km 62° ENE Bekopaka, Ankidrodroa River; Parc National Tsingy de Bemaraha, 3.4 km 93° E Bekopaka, Tombeau
Vazimba; Toamasina: Ivondro p. Tamatavé; Ilât Prune bei Tamatave; Tamatave; Res. Betampona, Ambodiriana
45km NW Toamasina; Res. Ambodiriana, 4.8 km 306°Manompana, along Manompana river; Parcell K9 Tampolo;
S.F. Tampolo, 10 km NNE Fenoarivo Atn.; Parcelle E3 Tampolo; Mahavelona (Foulpointe); Analalava, 7.0 km
255° Mahavelona; Manakambahiny Atsinanana; Forêt Ambatovy, 14.3 km 57° Moramanga; Torotorofotsy;
Andasibe National Park, botanic garden near entrance, West of ANGAP office; 7 km SE Andasibe National Park
Headquarters; Fianarantsoa:Riv: Morongolo Aff de Rongaronga; Local: Antanandava PK 285 RN2; Nat. Pk.
Ranomafana, Miaranony Forest; Ranomafana Nat. Park; Ranomafana Nat. Park, Vohiparara, Hotel; 8km NE
Kianjavato, Vatovavy forest; Nat. Pk.Ranomafana, Miaranony Forest; Ranomafana Nat. Park, Tsarahomanana; 7 km
W Ranomafana; 8km E Kianjavato, Vatovavy Forest; 7.6 km 122° Kianjavato, Forêt Classée Vatovavy; Manakara;
Parc National d'Isalo, Sahanafa River, 29.2 km 351° N Ranohira; Forêt d'Analalava, 29.6 km 280° W Ranohira;
Farafangana; 29.5 km WNW Tolanaro, Vasiha Mt.; Toliara: Andohahela, Parcel #1 versante E.; 29km NNW
Ranohira, Isalo N.P.; Vohibasia Forest, 59 km NE Sakaraha; near road, Zombitse National Park, Tulear Prov.; near
ANGAP office, Zombitse National Park, Tulear Prov.; Mikea Forest, deciduous dry forest, Tulear Province; Mikea
Forest, spiny forest, Tulear Province; Ranobe; Fiherenana; Beza-Mahafaly, 27 km E Betioky; Beza-Mahafaly,
Parcel 1; 70.7 km NNE Tolanaro, Mahermano Mt.; Rés. Andohahela, 6 km SSW Eminiminy; 2.7 km WNW 302°
Ste. Luce; Andohahela; Réserve Privé Berenty, Forêt d'Anjapolo, 21.4 km 325° NW Amboasary; Tsimelahy - Parcel
II, Andohahela National Park, transition forest, Tulear Province; Mandena, 8.4 km NNE 30° Tolagnaro; Réserve
Privé Berenty, Forêt de Bealoka, Mandraré River, 14.6 km 329° NNW Amboasary; Réserve Privé Berenty, Forêt de
Malaza, Mandraré River, 8.6 km 314° NW Amboasary; Réserve Berenty; Res. Berenty; Forêt de Petriky, 12.5 km
W 272° Tolagnaro.
Anochetus pattersoni Fisher sp. nov.
urn:lsid:zoobank.org:act:A1B9370B-2286-41D0-8E28-335C3514A76A
Figures: worker 7a-d; queen 7e,f; male 7g,h, 8d
Type Material. Holotype: worker, Seychelles Aldabra Group, Picard Island, in old "Settlement"
09°23'34"S 046°12'14"E 5 m, mostly Casuarina with coco palms, exotic vegetation, found after
dark on concrete slab in abandoned settlement 19-Dec-05 (coll. S.M.Goodman) collection code:
SMG14998 CASENT0068352 1w (CASC). CO1 barcode from same collection as holotype and
labeled CASENT0068352-D01
Worker measurements: maximum and minimum based on all specimens, n=8, (holotype): HL
1.32-1.40 (1.40), HW 1.25-1.31 (1.31), CI 93-95 (94), EL 0.20-0.26 (0.23), ML 0.67-0.72 (0.72),
MI 50-51 (51), SL 1.07-1.15 (1.15) SI 85-88 (88), WL 1.62-1.79 (1.78), FL 1.11-1.20 (1.19), PW
0.70-0.76 (0.74).
Queen measurements: maximum and minimum based on n=1. HL 1.31, HW 1.29, CI 99, EL
0.30, ML 0.64, MI 49, SL 1.05, SI 81, WL 1.81, FL 1.15, PW 0.79.
Male measurements: maximum and minimum based on n=2 from Madagascar: HL 0.86-0.87,
HW 1.07-1.10, CI 124-126, EL 0.65-0.67, SL 0.18, SI 17, WL 1.72-1.77, FL 1.21-1.26
Worker Diagnosis: Dorsal margin of petiole node concave medially (not visible in figures of the
workers but easily seen in the queen in Figure 7f.) Anterior portion of pronotal dorsum lightly
sculptured compared to posterior portion of pronotum. Propodeal dorsum and angle transversely
coarsely rugose, declivitous face below angle with transverse striae, with sculpture thinning near
base of face; propodeum angulate in lateral view. Petiole scale broad; anterior half of first gastral
14
tergum smooth and shiny with only fine punctures at base of setae. This species is most similar
to the graeffei a widespread species across the Indo-Pacific, but differs from the latter by the
pattern of sculpture on the mesosomal dorsum, shape the petiole (concave), broader petiole node
as seen in lateral view, and its much larger size (HL + ML 1.99 - 2.12 mm inpattersoni, HL +
ML < 1.75 mm in graeffei).
Distribution and biology. This species is limited to the Aldabra group islands with most
collections from Isle Picard. References and records to Anochetus madagascarensis [e.g. Forel
25:159] most likely refer to this species. No other species of Anochetus have been recorded from
the Seychelles. Males have been collected in Malaise traps, and a queen with clear wing scares.
Diagnostic barcoding loci. A. pattersoni: G-183, G-264, A-399, A-489, A-505, A-552.
Additional material examined for Anochetus pattersoni: In addition to the type material,
specimens from the following localities were examined in this study. Seychelles: Aldabra Group:
South Island (Grand Terre), Dune Patates 5-Jun-74 (Coll: V. Spaull) CASENT0102280 3w (BMNH); Isle Picard 12-
25 Mar-85 (Col: P.Mundel) CASENT0103343 1dQ, CASENT0103344 1w (CASC), MCZ.3680w 1w (MCZC); Ile
Picard Settlement, 11; (ANIC32-015992) 1-Nov-68 (coll: W.F.Humphreys) CASENT0172374 1w (ANIC); Ile
Polymnie, Anse Cedres, 155; (ANIC32-015991) 1-Nov-68 (coll: W.F.Humphreys) CASENT0172375 1w (ANIC);
Cosmoledo, Menai 17-Dec-05 (col: J.Gerlach) CASENT0172609 1w (LACM); Grande Terre, Aldabra 15-Dec-05;
(coll: J.Gerlach) CASENT0172610 1w (LACM); Aldabra Islands, Picard 22-29 Sep-05 ex malaise trap 6m (coll:
K.Mach & O.Maurel) CASENT0172611 1m (LACM); Aldabra Islands, Picard 22-26 May-05 (coll: K.Mach &
O.Maurel) CASENT0172617 1m (LACM).
Check-List of Malagasy Odontomachus Species
coquereli Roger, 1861
= coquereli minor Emery, 1899
troglodytes Santschi, 1914
= haematodus stanleyi Wheeler 1922
simillimus Smith 1858
= haematoda breviceps, Crawley 1915
= haematodes fuscipennis Forel 1913
= pallidicornis Smith, F. 1860
Key to workers and queens of Malagasy Odontomachus (modified from Brown [1:117]:
1. Head narrow behind eyes; mandible with long, acute apical and preapical teeth; vertex of
head coarsely, transversely striate............................................................................coquereli
Head only slightly narrower across vertex than across eyes, with distinct extraocular furrows
and temporal ridges; apical and preapical teeth of mandible short and blunt; vertex finely
striate longitudinally, diverging behind ................................................................................. 2
2. Metasternal process acute, forming paired, slender spines, often unequal in length (Fig.
13a). Petiole spine notably bent posteriorly at base..............................................troglodytes
Metasternal process low, rounded (Fig. 13b). Petiole spine slightly curved posteriorly,
comma but not noticeably bent posteriorly at base of spine..................................simillimus
15
Key to males of Malagasy Odontomachus
1 Shortest distance between lateral ocellus and margin of compound eye smaller than
maximum length of ocellus. Antenna with suberect setae; declivitous surface of
propodeum without distinct rugae (Madagascar)....................................................coquereli
Shortest distance between lateral ocellus and margin of compound eye distinctly greater than
maximum length of ocellus. Antenna with very short appressed to decumbent setae;
declivitous surface of propodeum with distinct rugae directed towards margins .................2
2 Body brownish yellow. Tarsal claw with small subapical tooth (Madagascar).......troglodytes
Body blackish or brown. Tarsal claw without subapical tooth (Seychelles).............simillimus
Odontomachus coquereli Roger
Figures: worker 1b, 10a,b, 13c; queen 10c,d; male 11a,b,e; map 14a
Type material:
Odontomachus coquereli Roger, 1861: 30 [26]. Lectotype: worker, Madagascar (Coquerel)
(ZMHB), present designation [examined] AntWeb CASENT0104549.
Odontomachus coquereli minor Emery 1899: 273 [27]. Lectotype; worker, Madagascar, Baie d'
Antongil (Mocquerys) (MSNG), present designation [examined] AntWeb
CASENT0102021. Synonymized with coquereli by Brown, 1978: 557 [2].
Worker measurements: maximum and minimum based on n=45 from Madagascar: HL 2.69-
3.27, HW (across vertex) 1.26-1.77, HW (across upper eye margin) 1.54-2.02, CI 57-67, EL
0.46-0.55, ML 1.76-2.16, MI 61-68, SL 3.04-3.96, SI 164-207, WL 4.18-5.11. FL 3.32-4.68, PW
1.11-1.53.
Queen measurements: maximum and minimum based on n=5 from Madagascar: HL 2.81-2.94,
HW (across vertex) 1.39-1.55, HW (across upper eye margin) 1.83-1.98, CI 62-71, EL 0.45-0.55,
ML 1.66-1.81, MI 59-62, SL 3.07-3.29, SI 155-179, WL 4.35-4.56, FL 3.60-3.84, PW 1.28-1.43.
Preapical teeth count 7-10.
Male measurements: maximum and minimum based on n=5 from Madagascar: HL 1.11-1.22,
HW 1.41-1.57, CI 128-134, EL 0.78-0.90, SL 0.30-0.38, SI 21-23, WL 3.38-3.85, FL 2.90-3.16.
Worker Diagnosis: Workers of this species can be easily distinguished from troglodytes by their
larger size, mandible with long, acute apical and preapical teeth and lack of extraocular furrows
and temporal ridges on vertex. Brown [2] provides a description and additional references.
Distribution and biology. O. coquereli is endemic to Madagascar and is restricted to eastern and
northern montane rainforest, lowland rainforest, and littoral forest from 10 to 1325 m (Fig. 10a).
It is most abundant at mid-elevations in the northeast such as in Marojejy National Park. Nests of
O. coquereli are most commonly found in rotten logs and consist of small colonies. Queens of
coquereli are wingless and very similar to workers; colonies reproduce by fission [28]. Males are
collected in Malaise traps and yellow pan traps. Workers forage on the ground day and night. A
few times BLF has seen solitary foragers high up on trunks and branches of large trees. It is not
clear if they are foraging for plant or insect liquids up in the canopy.
16
There is notable geographic variation in shape of petiole, sculpture and number of preapical
teeth. Preapical teeth and denticles range from 7-12. Occasionally, adjacent teeth may be fused at
base to form a single bidententate tooth. However, there is no consistent concordant pattern to
this variation. Molecular data are also extremely variable - suggesting that these isolated
populations have long been separated. Rather than describing these populations as distinct
species, we leave them here as a single species - a hypothesis that can be tested in the future with
subsequent experiments in both the field and lab.
CO1: The barcode region is extremely variable (Fig. 16) - there is evident isolation by distance
which is largely concordant with the biogeographic regions proposed by Wilme et al. [29].
Diagnostic barcoding loci. O. coquereli: T-96, C-196, T-211, T-280, A-283.
Discussion: Odontomachus coquereli from Madagascar, the only species in the genus where
winged queens have never been found. Molet et al. [28] investigated the Marojejy population of
O. coquereli, and based on demography, morphometry, allometry and ovarian dissections
demonstrated that the winged queen caste has been replaced by a wingless reproductive caste and
that the strategy of colonial reproduction is fission. A single wingless reproductive (ergatoid)
was found in each colony. The smallest colonies consisted of at least 5 workers and the largest
colonies never exceeded 40 workers, indicating a threshold size at which a colony divides in two
daughter colonies. In contrast, O. troglodytes reproduces by non-claustral independent
foundation and colonies can reach 1300 workers [30]. As in A. goodmani and A. boltoni, the
other species without winged queens - there are deep CO1 divergences between different
collection localities.
Specimens examined for Odontomachus coquereli:
Specimens from 134 separate collection events from the following 57 localities were examined.
MADAGASCAR: Province Antsiranana:Forêt de Binara, 9.4km 235° SW Daraina; R.S. Manongarivo, 12.8 km
228° SW Antanambao; R.S. Manongarivo, 14.5 km 220° SW Antanambao; RNI Marojejy, 8km NW Manantenina;
Parc National de Marojejy, Manantenina River, 27.6 km 35° NE Andapa; Parc National de Marojejy, Manantenina
River, 28.0 km 38° NE Andapa; Parc National de Marojejy, Antranohofa, 26.6 km 31° NNE Andapa; Forêt
Ambanitaza, 26.1 km 347° Antalaha; Rés. Anjanaharibe-Sud, 6.5 km SSW Befingotra,; Res. d' Anjanaharibe-Sud,
17km W Andapa; Province Toamasina: 6.9 km NE Ambanizana, Ambohitsitondroina; Montagne d'Anjanaharibe,
19.5 km 27° NNE Ambinanitelo; Montagne d'Anjanaharibe, 18.0 km 21° NNE Ambinanitelo; Montagne
d'Akirindro 7.6 km 341° NNW Ambinanitelo; Parc National Masoala, Ambanizana, ; 5.3 km SSE Ambanizana,
Andranobe; 1km W Andampibe, Cap Masoala; Parc National Mananara-Nord, 7.1 km 261° Antanambe; Res.
Ambodiriana, 4.8 km 306°Manompana, along Manompana river; Ile Sainte Marie, Forêt Kalalao, 9.9 km 34°
Ambodifotatra; Parcelle E3 Tampolo; Mahavelona (Foulpointe); Mahavelona (Foulpointe), Forest Andalava;
Reserve Betampona, Camp Vohitsivalana, 37.1 km 338° Toamasina; Reserve Betampona, Camp Rendrirendry 34.1
km 332° Toamasina; F.C. Andriantantely; 6km ESE Andasibe (=Perinet); Province Fianarantsoa: Nat.
Pk.Ranomafana, Miaranony Forest; Ranomafana Nat. Park, Valoloaka forest; Forêt d'Ambalagoavy Nord, Ikongo,
Ambatombe; 45km S. Ambalavao; Rés. Andringitra, 43 km S Ambalavao.
Odontomachus simillimus Smith:
Figures: worker 12a,b, 13b; queen 12c,d; male 12e,f;
Type material:
17
Odontomachus simillimus Smith, 1858: 80 [31]. Type locality: Fiji Islands [not examined].
Junior synonym of haematodus by Roger, 1861: 24 [26]; revived from synonymy by Wilson,
1959: 499 [32].
Odontomachus haematoda var. breviceps, Crawley, 1915: 239 [33]. Type locality: Christmas
Island, Australia (BMNH) [not examined]. Synonymized with simillimus by Brown, 1976:
106 [1].
Odontomachus haematodes var. fuscipennis Forel 1913: 19 [34].Type locality: Peradeniya, Sri
Lanka (MNHB?) [not examined]. Synonymized with simillimus by Wilson, 1959: 499 [32].
Ponerapallidicornis Smith, F. 1860: 73 [35]. Type locality: Makassar, Celebes (BMNH) [not
examined]. Synonymized with simillimus by Brown, 1976: 106 [1].
Worker measurements: maximum and minimum based on n=10 from Madagascar: HL 2.33-
2.63, HW (across vertex) 1.64-2.03, HW (across upper eye margin) 1.77-2.06, CI 75-81, EL
0.20-0.23, ML 1.14-1.28, MI 48-51, SL 2.16-2.43, SI 109-123, WL 2.62-3.06. FL 2.29-2.56, PW
1.02-1.24.
Queen measurements: maximum and minimum based on n=5 from Madagascar: HL 2.37-2.55,
HW (across vertex) 1.79-2.03, HW (across upper eye margin) 1.87-2.13, CI 79-84, EL 0.49-0.53,
ML 1.17-1.30, MI 49-52, SL 2.15-2.38, SI 111-118, WL 3.13-3.19. FL 2.36-2.58.
Male measurements: maximum and minimum based on n=1 from Madagascar: HL 0.89, HW
1.19, CI 133, EL 0.59, SL 0.19, SI 16, WL 2.44. FL 1.73.
Worker diagnosis: Workers and males are very similar in morphology and size to troglodytes
Bivariate plots of metric measurements did not distinguish the two species. Workers and queen
have fine, glossy dorsal striation on head and mesosoma. Metasternal process low and rounded
(Fig. 13b). Metasternal process can be viewed in mounted specimens by removing a hind leg and
coxa. Brown [1] provides a description and additional references.
Distribution and biology. Known though most of the literature as "O. haematodes" (Linnaeus)
1758 which is a different species. Forel's [25:159] record of "O. haematodes'" from Seychelles,
Mahe most likely refers to simillimus.
Found in clearings and secondary growth throughout the Indo-Pacific. The records from the
Seychelles clearly represent an introduction. O. simillimus is not known from Madagascar and
may have difficulty in establishing on Madagascar because of the presence of the
morphologically and ecologically similar O. troglodytes.
CO1. The average within species CO1 divergence for O. simillimus was 3.212 % with much
variation between islands (Max 5.786, SE=0.273). Importantly, although bivariate plots of
worker measurements do not reliably separate O. simillimus from the ecologically similar O.
troglodytes, the two species are, on average, 7-8% divergent within the CO1 barcode.
Diagnostic barcoding loci. O. simillimus: C-265, T-267, T-528.
18
Specimens examined for Odontomachus simillimus: Additional details are provided for the
specimens from Seychelles.
INDONESIA: Irian Jaya, Maffin Bay; PT. Freeport Concession, Siewa Camp; PAPUA NEW GUINEA: Los
Negros, Admiralty Islands; Milne Bay, Morobe, Finschhafen, Biak Island; PHILIPPINES: Leyte, Tacloban;
SEYCHELLES: Silhouette Island, Grande Barbe, 7/22-23/2000, J.Gerlach; Silhouette Island, Jardin Marron,
7/5/2000, J.Gerlach; SOLOMON ISLANDS: Kungana Bay, Rennell Island; Guadalcanal, Tenaru River; Kungana
Bay, Rennell Island, Anuda Island; NW end of Bellona Island; Tevia Bay, Vanikoro Island, Santa Cruz Islands;
Mohawk Bay, Matema Island, Santa Cruz Islands, Pavuvu, Russell Island; VANUATU: Espiritu Santo Island.
Odontomachus troglodytes Santschi
Figures: worker 10e,f, 13a; queen 10g,h; male 11c,d,f; map 14b
Type material: Odontomachus haematodes troglodytes Santschi, 1914: 58 [36]. Lectotype
worker: Kenya, Shimoni cave (NHMB), designated by Brown, 1976: 106 [2] [examined]
AntWeb CASENT0101134. Raised to species Brown, 1976: 106 [1].
Odontomachus haematodus stanleyi Wheeler, 1922: 102 [37]. Type worker: DRC (Zaire)
Stanleyville, 25° 10'E, 0°30'N Feb 1915, (AMNH) [examined] AntWeb CASENT0104653,
CASENT0104654. Synonymized with troglodytes by Brown, 1976: 106 [1].
Worker measurements: maximum and minimum based on n=15 from Madagascar: HL 2.23-
2.66, HW (across vertex) 1.56-1.92, HW (across upper eye margin) 1.69-1.98, CI 74-78, EL
0.40-0.47, ML 1.13-1.33, MI 45-54, SL 2.07-2.42, SI 117-127, WL 2.61-3.07. FL 2.28-2.65, PW
1.02-1.19.
The specimens from Madagascar are notably smaller than specimens in CAS collection from
South Africa, central Africa and Sao Tome. Maximum and minimum measurements based on
n=5: HL 2.52-2.94, HW (across vertex) 1.81-2.25, HW (across upper eye margin) 1.94-2.31, CI
74-79, EL 0.41-0.51, ML 1.19-1.38, MI 47-49, SL 2.24-2.53, SI 110-122, WL 2.88-3.23. FL
2.42-2.91, PW 1.13-1.36.
Queen measurements: maximum and minimum based on n=5 from Madagascar: HL 2.59-2.74,
HW (across vertex) 1.99-2.19, HW (across upper eye margin) 2.05-2.18, CI 78-79, EL 0.56-0.59,
ML 1.39-1.44, MI 52-55, SL 2.36-2.52, SI 112-119, WL 3.18-3.49. FL 2.67-2.76.
Male measurements: maximum and minimum based on n=5 from Madagascar: HL 1.00-1.04,
HW 1.30-1.35, CI 127-133, EL 0.68-0.70, SL 0.22-0.26, SI 17-19, WL 2.52-2.59. FL 1.80-1.88
Worker Diagnosis: Workers of this species can be easily distinguished from coquereli by their
smaller size, distinct extraocular furrows and temporal ridges on vertex and short and blunt
mandibular teeth. Brown (1976) provides additional description and references.
Distribution and biology. O. troglodytes was first reported from Madagascar by André [38:290]
as O. haematodes (Linnaeus). African and Malagasy records of haematodes actually refer to
troglodytes. In Madagascar, troglodytes is widespread throughout the east in secondary habitats,
including coastal scrub, eucalyptus plantations, littoral forest, and rainforest below 800 m
elevation. This species is also widespread across sub-Saharan Africa in second growth forests
and open habitats. Forel [25:159] recorded Odontomachus (as haematodes) from Seychelles.
19
These specimens have not been examined but probably refer to O. simillimus and not
troglodytes.
Because of its preference of secondary habitats, it is possible that troglodytes in Madagascar is a
recent colonist from Africa, possibly introduced by humans. This is in contrast to coquereli
which is most closely related to Melanesian species in the tyrannicus group.
Our collections in Madagascar were focused primarily on less disturbed habitats, thus the
distribution map (Fig. 10b) probably does not reflect the full extent of its range. O. troglodytes
was most often recorded nesting in rotten logs (30 collection records) followed by sifted litter
(15). Males were collected at light, malaise traps, and yellow pan traps.
A lab colony was kept for a number of months and thrived on a diet of crickets, producing
numerous larvae, brood, and males. The trap jaw behavior is very similar to that of O. bauri [39,
Fisher unpublished]. When disturbed, the specimen use trap jaw propulsion to "jump" away.
CO1. Shallow intraspecific and deep interspecific divergences between O. troglodytes in
Madagascar and Africa and the other species - what one might expect if it has been recently
introduced. Average within species sequence divergence of 0.4% (Figs 15, 17).
Diagnostic barcoding loci. O. troglodytes: G-1659, G-465, G-519, T-535, A-537.
Specimens examined for Odontomachus troglodytes: Specimens from 105 separate collection
events from the following 40 localities were examined. CAMEROON: Sud: Res. de Faune de Campo, 2.16
km 106° ESE Ébodjé; Sud-Ouest: Bimbia Forest, 7.4 km 119° ESE Limbe. CENTRAL AFRICAN REPUBLIC:
Prefecture Sangha-Mbaéré: Parc National Dzanga-Ndoki, 39.6 km 174° S Lidjombo; Parc National Dzanga-Ndoki,
38.6 km 173° S Lidjombo; Parc National Dzanga-Ndoki, 37.9 km 169° S Lidjombo; Réserve Spéciale de Forêt
Dense de Dzanga-Sangha, 12.7 km 326° NW Bayanga; Parc National Dzanga-Ndoki, Mabéa Bai, 21.4 km 53° NE
Bayanga. GABON: Estuaire: Pointe Ngombe, Ekwata, 16 km 240° WSW Libreville; Libreville; F.C. Mondah, 21
km 331° NNW Libreville. GABON: Ogooue-Maritime: Aire d'Exploit. Rationnelle de Faune des Monts Doudou,
25.2 km 304° NW Doussala; Reserve de la Moukalaba-Dougoua, 12.2 km 305 NW Doussala; Reserve de Faune de
la Moukalaba-Dougoua, 12.2 km 305° NW Doussala; Reserve de Faune de la Moukalaba-Dougoua, 10.8 km 214°
SW Doussala; Woleu-Ntem: 31.3 km 108° ESE Minvoul; KENYA: [Côte d' Afrique or. angl. Shimoni; LIBERIA:
Sapo Nat. Park. MADAGASCAR: Toamasina: Mahavelona (=Foulpointe); 5.3 km SSE Ambanizana, Andranobe;
Forêt d'Analava Mandrisy, 5.9 km 195° Antanambe; Res. Ambodiriana, 4.8 km 306°Manompana, along
Manompana river; Ile Sainte Marie, Forêt Ambohidena, 22.8 km 44° Ambodifotatra; Ile Sainte Marie, Forêt
Ampanihy, 14.4 km 52° Ambodifotatra; Ile Sainte Marie, Forêt Kalalao, 9.9 km 34° Ambodifotatra; Parcell K9
Tampolo; Tampolo; S.F. Tampolo, 10 km NNE Fenoarivo Atn.; Parcelle E3 Tampolo; Parcelle K7 Tampolo; Bridge
at Onibi, NW of Mahavelona; Mahavelona (Foulpointe); 2.1 km 315° Mahavelona; Toamasina (Tamatave); Prison
de Tamatave; Station forest de Tampolo, 10km N Fenerive; Res. Betampona, Ambodiriana 45km NW Toamasina;
10k N Brickaville; 11km SE Ampasimanolotra (=Brickaville); Fianarantsoa:: Riv: Ranomafana Aff. de laroka;
Local: Ranomafana RN2; Riv: laroka Aff de Rianila; Local: Manakana; Riv: Mahatsara Aff de Rianila; Local: Piste
vers Brickaville; Riv: Rongaronga; Local: Ambodifaho; Riv: Rianila (Ivohitra); Local: Antseranambe; Riv:
Santaravina; Local: Ampasipotsy-pont routier; Riv: Sandragniro; Local: Tanambao-Pont routier; Riv: Farimbogna;
Local: Village 202 (Pont routier RN2); Riv: Ilazana; Local: Gri-gri; 8k E Kianjavato Vatovavy Forest; Ranomafana
Nat. Park; 10k E Ranomafana; Ranomafana Nat. Park, 10km E; Mananjary 2 km south; 7.6 km 122° Kianjavato,
Forêt Classée Vatovavy; SOUTH AFRICA: Mpumalanga: Songimuelo Nat. Reserve, Kromdraai Camp, Komati
River; Natal: Mtunzini; Limpopo: Dunstable Farm, 27 km E of Hoedspruit. DEMOCRATIC REPUBLIC OF
THE CONGO: Stanleyville; Epulu.
Complementary analyses to CO1
20
In some instances we chose to amplify independent nuclear markers to help interpret CO1
divergences involving populations where specimens were morphologically cryptic. Because of
their high copy number and relatively conserved primer regions, we selected three ribosomal
regions to amplify: 18S, 28S and ITS1. We had high expectations for the utility of these markers
to complement the mtDNA barcode analysis based on our own experiences with other taxa
[40,41], the utility of these markers in other taxonomic groups where, for instance, ITS1
functions as a barcode [42], and, for 28S, based on predictions of others for the utility of this
region as an alternative barcode region [43]. Unfortunately, we found that, while the CO1 data
from species with exclusively (putatively) ergatoid queens had large phylogeographic signal,
when compared to the three rRNA regions we utilized it was markedly simpler to generate,
interpret and analyze. The rRNA markers utilized here, particularly 18S and 28S, can be useful
for identifying interspecific (species as revised here) hybridization [see 40,41,43].
Discussion
The role of CO1 barcoding in taxonomic revision
In traditional morphology-based taxonomy, morphologically discrete forms are tentatively
recognized and hypothesized to be species. Taxonomists search for consistent phenotypic
discontinuities that may indicate the occurrence of reproductive isolation. Many ant species,
however, show considerable geographical variation in morphological characters. An additional
complication for morphology-based taxonomy is the difference between castes within the same
species, e.g. males, major and minor workers, and queens. Sequence data provide an alternative
set of characters to assist in inferring species boundaries. In addition, like morphological data,
hypotheses can be evaluated in light of additional data on specimen distribution, biology, and
behavior. In the example of Anochetus of Madagascar, sequence data impacted the taxonomic
process at the following steps:
Caste association
Caste association, including male/female association, is a powerful contribution to taxonomic
studies, especially for ants, which vary tremendously in morphology between sexes and castes.
In this study, CO1 divergence was the principal source of data for revealing that small and large
workers and queens are the same species. Though no morphological distinction in addition to
size between the forms was noted, it remained unclear whether they belonged to the same species
since no colony collection contained both size classes, even though they are often collected at the
same site. One explanation is that small workers are produced by small queens. Small queens
may represent an alternative reproductive strategy and may be only rarely produced by large
queens. Further research will explore the reproductive biology of this species. The sequence data
also confirmed the association of males collected in Malaise traps with the worker caste.
Type designation
The identities of many valid names are in question in Madagascar because insufficient
geographic and morphological information was provided in their original descriptions, or type
specimens are of uninformative minor worker castes or are damaged. For Anochetus, description
of new species included the DNA barcode of a specimen from the paratype colony series to
21
provide an additional tool for associating the name with type specimens. This facilitates linking
the name to the type specimen if the identity of the type is called into question.
Evolutionary questions and biogeographic patterns
Sequencing revealed patterns of geographic coherence and divergence that were not revealed in
morphological analysis. A good example of this is the deep divergence in isolated populations of
A. goodmani, and O. coquereli (see Species as hypotheses below). These results will direct future
morphological and evolutionary studies on these divergent populations.
Identification
In-depth morphological study, a more time-consuming process than the DNA analysis
undertaken in this study, was applied to outliers identified by the DNA analysis. For example, in
the inventory described in part I, 22 collections of Anochetus from three species were included.
All were correctly identified using sequence data. Specimens within the same species that
showed high sequence divergence, however, were culled for morphological scrutiny (e.g. A.
madagascarensis from Amato and Binara).
Biogeography
This combination of traditional taxonomy and DNA barcoding has produced a wealth of
biogeographic hypotheses to be tested. Do more basal lineages have more restricted or wider
distributions, compared to younger taxa? Are evident patterns of genetic isolation by distance
within the ergatoid ponerines examined here shared by all those with wingless queens? Are the
mechanisms of isolation the same? Do the phylogeographic groupings correspond with the
Wilme et al. [29] biogeographic regions hypothesized largely as related to primates? Taxonomy
has always had this style of iterative hypothesis testing, but adding an explicit molecular
component as with DNA barcoding - allows these hypotheses to be more transparent
Species as hypotheses
The existence of any species is a hypothesis to be tested, and the transparency of species
delimitation is one of the major additions that DNA barcoding brings to systematics. In our
analysis, the deep sequence divergences within A. goodmani suggests that populations from the
north and south of western Madagascar have a long history of isolation, and could in fact be
separate species (Fig. 6). However, there are alternate hypotheses. This species has wingless
queens. Species of ants that lack winged queens, reproduce by fission and have reduced dispersal
ability, particularly when measured using a maternally inherited genetic marker. Thus, we might
expect that those populations now restricted to isolated relict pockets of moist habitat in the dry
west would show deep divergence [for example - 44-46], and represent distinct, evolutionarily
significant units [47], if not distinct species. By contrast in A. madagascarensis and A.
grandidieri, where only winged queens have been observed, within-species sequence
divergences are much lower. We are currently testing the hypothesis that female-limited
dispersal has caused the extremely site-specific phylogeographic signal by assaying nuclear
genes. It is possible that these populations, separated at such a large spatial scale, will show
strong genetic differentiation for both nuclear and mtDNA markers between localities [44]. The
CO1 analysis does not unequivocally indicate that A. goodmani is more than one species, but it
does suggest future hypotheses of species membership to be tested.
22
Molecular approaches to species identification have been criticized for potentially overestimating
[48,49], and/or underestimating biodiversity. Species diversity will be underestimated when
collections include quickly evolving species-pairs [9] where interspecific divergences are less
than or equal to intraspecific variation. Our data set contains one potential example of this
phenomenon: individuals of Anochetus goodmani collected from Binara on the north east coast
and Parc National de Kirindy Mite on the south west coast. Individuals from these populations
are separated by, on average, 6.0 % sequence divergence. Are these populations operating as
separate species? Are these populations members of the same species but highly divergent? Our
data alone cannot answer this question. But, of critical import, our data have identified a
surprising level of within-species divergence and lays bare these differences to further study. A
standard arthropod molecular clock for CO1 is 1.2-1.5% per million years [50-52]. In
hymenopterans the rate for this gene is accelerated [53], and therefore average estimates should
be interpreted with caution. However, the higher rates suggest that populations have been
isolated for several hundred thousand years. The opportunity now exists to employ a suite of
approaches (behavioral observations, tests of interbreeding, and phylogeographic resolution of
more quickly evolving genetic markers) to test species membership.
CO1 and complementary genetic analyses:
Of all the molecular data used here, the CO1 data was by far the easiest to generate and interpret.
While an inter-gene/genomic comparison of utility was not the intent of this research, we feel it
important to comment on these differences here, while presenting a full multigene
phylogeographic analysis of the covariance of genetic diversity and geographic separation in
another manuscript. Within the context of a species description or revision, the relevant
information here is that:
1) The CO1 barcode was very easy to generate. While the majority of specimens
analyzed here are between 1-2 years old, we did generate full length barcodes (>600bp) for
specimens up to 14 years old. Barcodes were generated with the same primers and reaction
conditions. Alternatively, rRNA data, variable at a species level, was often challenging to
generate (i.e. sequence) due to long regions of t-repeats and uncharacterized intra-individual
variation (in ITS1).
2) We found no evidence for Numts [54] or other misplaced nuclear markers that would
introduce conflict into our analysis if not spotted,
3) CO1 sequences never showed intra-individual variation as did some of the rRNA
markers, and
4) Although the species described here (especially O. coquereli, A. goodmani and A.
boltoni) contain large CO1 divergences, such variation is always geographically segregated, as
one might expect from a species where the queens (when known) are ergatoid.
In the worst-case scenario, by describing species containing large intra-specific CO1
divergences, we have missed morphologically cryptic diversity within these species. However,
the DNA data, collection records, measurements and photo-digital accessions are all preserved in
publicly accessible databases, facilitating the testing (and potential refutation) of our one-species
hypothesis in the traditional, iterative, process of alpha-taxonomy.
Collaborative Taxonomy
23
Species inventories are essential for documenting global diversity and generating necessary
material for taxonomic study. However, for inventories to be relevant in the short term, the
taxonomic process must reduce the bottlenecks in describing and identifying specimens. The
shear diversity of arthropods can easily overwhelm an inventory system with too many
specimens, the bulk of which are outside the focal expertise of the taxonomists. As an example,
the NSF-funded Arthropod Inventory of Madagascar has shipped over a third of million
specimens to over 150 participating taxonomic collaborators [5]. Major taxonomic products from
these inventories, which will take decades to produce, represent only a fraction of the diversity
collected, and provide no short-term return of biodiversity data to Madagascar.
The development of "collaborative taxonomy" would permit researchers to participate
collectively in an accelerated team-driven taxonomic process. Key participants in collaborative
taxonomy are (i) inventory teams led by conservationists, ecologists, and taxonomists, (ii)
traditional morphology-based taxonomists equipped with imaging tools, and (iii) geneticists.
Under this plan, inventory teams would generate specimens and sequence data in collaboration
with geneticists. Geneticists, in turn, would work directly with the taxonomist who identifies the
need for additional sequencing of specimens. Taxonomists would then combine extensive
sequencing data with their morphological and ecological analysis, assisted by new technologies
in digital imaging and web-based delivery (e.g. www.antweb.org and www.barcodinglife.org), to
infer species limits and frame evolutionary context for species.
Nothing can replace the countless hours of careful observation necessary to understand variation
and to delimit species boundaries. However, the addition of sequence data provides a means to
create short-term results from inventories and at the same time generate data helpful to
taxonomists. For taxonomists, sequencing highlights the specimens most deserving of focused
study. We tested this collaborative model by revising the ant genera Anochetus and
Odontomachus of Madagascar using a combination of morphological and genetic character sets
based on inventories in Madagascar.
Future
This study demonstrates how sequence data, combined with morphological analysis and
innovations in imaging and web delivery, have set the stage for accelerated discovery and
documentation of global species diversity. The combination of DNA sequence data with
inventory and traditional taxonomy is a model that can be applied across disciplines and will
allow analytical needs to scale to the enormity of the biodiversity crisis [55]. It will help in the
identification and conservation of the evolutionary processes that generate and preserve
biodiversity.
Little time remains to document and protect global biodiversity. Taxonomists, equipped with
modern tools and collaborations, have a chance to move systematics to the forefront of
conservation and the public's attention. With increased taxonomic output and improved public
access and visibility, public support for the discovery of life on this planet will follow.
Acknowledgments
24
We thank April Nobile for creating the images. We thank Alma Saucedo and Kelly Herbinson
for assistance with measurements and Taika von Konigslow and Kate Crosby for their diligent
assistance in the lab. Barry Bolton, James Trager, Wojciech Pulawski provided careful reviews
of earlier drafts of the manuscript. Richard Pyle kindly provided the first Formicidae LSIDs for
the new names described herein.
References
1. Brown WL, Jr. (1976) Contributions toward a reclassification of the Formicidae. Part VI.
Ponerinae, tribe Ponerini, subtribe Odontomachiti. Section A. Introduction, subtribal
characters. Genus Odontomachus. Studia Entomologica 19: 67-171.
2. Brown WL, Jr. (1978) Contributions toward a reclassification of the Formicidae. Part VI.
Ponerinae, tribe Ponerini, subtribe Odontomachiti. Section B. Genus Anochetus and
bibliography. Studia Entomologica 20: 549-638.
3. Brady SG, Schultz TR, Fisher BL, Ward PS (2006) Evaluating alternative hypotheses for the
early evolution and diversification of ants. Proceedings of the National Academy of
Sciences of the United States of America 103: 18172-18177.
4. Ouellette GD, Fisher BL, Girman DJ (2006) Molecular systematics of basal subfamilies of
ants using 28S rRNA (Hymenoptera : Formicidae). Molecular Phylogenetics and
Evolution 40: 359-369.
5. Fisher BL. A Model for a Global Inventory of Ants: A Case Study in Madagascar. In:
Jablonski NG, editor; 2005. Proceedings of the California Academy of Sciences 56: 78-
89.
6. Polaszek A, Agosti D, Alonso-Zarazaga M, Beccaloni G, de Place Bj0rn P, Bouchet, P,
Brothers DJ, Earl of Cranbrook, Evenhuis N, Godfray HCJ, Johnson NF, Krell F-T,
Lipscomb D, Lyal CHC, Mace GM, Mawatari S, Miller SE, Minelli A, Morris S, Ng
PKL, Patterson DJ, Pyle, RL, Robinson N, Rogo L, Taverne J, Thompson FC, van Tol J,
Wheeler QD, Wilson EO (2005) Commentary: A universal register for animal names.
Nature 437: 477.165
7. Polaszek A, Alonso-Zarazaga M, Bouchet P, Brothers DJ, Evenhuis N, Krell F-T, Lyal CHC,
Minelli A, Pyle RL, Robinson NJ, Thompson FC, van Tol J (2005) ZooBank: the open-
access register for zoological taxonomy: Technical Discussion Paper. Bulletin of
Zoological Nomenclature 62: 210-220
8. Pyle RL, Earle JL Greene, BD (2008) Five new species of the damselfish genus Chromis
(Perciformes: Labroidei: Pomacentridae) from deep coral reefs in the tropical western
Pacific. Zootaxa 1671: 3-31.
9. Hebert PDN, Cywinska A, Ball SL, DeWaard JR (2003) Biological identifications through
DNA barcodes. Proceedings of the Royal Society of London Series B-Biological
Sciences 270: 313-321.
10. Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one:
DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes
fulgerator. Proceedings of the National Academy of Sciences of the United States of
America 101: 14812-14817.
11. Hajibabaei M, DeWaard JR, Ivanova NV, Ratnasingham S, Dooh RT, et al. (2005) Critical
factors for assembling a high volume of DNA barcodes. Philosophical Transactions of
the Royal Society B-Biological Sciences 360: 1959-1967.
25
12. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Series 41: 95-98.
13. Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions
through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16:
111-120.
14. Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution 4: 406-425.
15. Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for molecular evolutionary
genetics analysis and sequence alignment. Briefings in Bioinformatics 5: 150-163.
16. Ratnasingham S, Hebert PDN (2007) BOLD: The Barcode of Life Data System
(www.barcodinglife.org). Molecular Ecology Notes 7: 355-364.
17. Tajima F (1989) Statistical method for testing the neutral mutation hypothesis by DNA
polymorphism. Genetics 123: 585-595.
18. Rozas J, Rozas R (1999) DnaSP version 3: an integrated program for molecular population
genetics and molecular evolution analysis. Bioinformatics 15: 174-175.
19. Lou M, Golding GB (2007) fingerprint: visual depiction of variation in multiple sequence
alignments Molecular Ecology Notes: doi: 10.1111/j.1471-8286.2007.01904.x.
20. Braig HR, Zhou W, Dobson SL, O'Neill SL (1998) Cloning and Characterization of a Gene
Encoding the Major Surface Protein of the Bacterial Endosymbiont Wolbachia pipientis.
Journal of Bacteriology 180: 2373-2378.
21. Forel A (1891) Les Formicides. [part] In: Grandidier, A. Histoire physique, naturelle, et
politique de Madagascar. Volume XX. Histoire naturelle des Hyménoptères. Deuxième
partie (28e fascicule). Paris: Hachette et Cie, v + 237 pp.
22. Santschi F (1928) Descriptions de nouvelles fourmis ethiopiennes (quatrième note). Revue de
Zoologie et de Botanique Africaines 16: 54-69.
23. Forel A (1887) Fourmis récoltées à Madagascar par le Dr. Conrad Keller. Mitteilungen der
Schweizerischen Entomologischen Gesellschaft 7: 381-389.
24. Forel A (1918) Quelques fourmis de Madagascar récoltées par le Dr. Friederichs et quelques
remarques sur d'autres fourmis. Bulletin de la Société Vaudoise des Sciences Naturelles
52: 151-156.
25. Forel A (1912) The Percy Sladen Trust Expedition to the Indian Ocean in 1905, under the
leadership of Mr. J. Stanley Gardiner, M.A. Volume 4. No. XI. Fourmis des Seychelles et
des Aldabras, reçues de M. Hugh Scott. Transactions of the Linnean Society of London.
Zoology (2)15: 159-167.
26. Roger J (1861) Die Ponera-artigen Ameisen (Schluss). Berliner Entomologische Zeitschrift
5: 1-54.
27. Emery C (1899) Formiche di Madagascar raccolte dal Sig. A. Mocquerys nei pressi della
Baia di Antongil (1897-1898). Bullettino della Società Entomologica Italiana 31: 263-
290.
28. Molet M, Peeters C, Fisher BL (2007) Permanent loss of wings in queens of the ant
Odontomachus coquereli from Madagascar. Insectes Sociaux 54: 183-188.
29. Wilmé L, Goodman SM, Ganzhorn JU (2006) Biogeographic evolution of Madagascar's
microendemic biota. Science 312: 1063-1065.
30. Colombel P (1971) Étude biométrique du couvain et des adultes d'Odontomachus
haematodes (Hym. Form. Poneridae). Annales de la Faculté des Sciences, Université
Fédérale du Cameroun 6: 53-71.
26
31. Smith, F., 1858. Catalogue of hymenopterous insects in the collection of the British Museum.
Part VI. Formicidae. British Museum (Natural History), London, 216 pp.
32. Wilson EO (1959) Studies on the ant fauna of Melanesia V. The tribe Odontomachini.
Bulletin of the Museum of Comparative Zoology 120: 483-510.
33. Crawley, W. C. 1915. Ants from north and south-west Australia (G. F. Hill, Rowland Turner)
and Christmas Island, Straits Settlements. Part II. Ann. Mag. Natur. Hist., 15: 232-239
34. Forel, A. 1913. Ameisen aus Sumatra, Java, Malacca und Ceylon. Gesammelt von Herrn
Prof. Dr. v. Buttel-Reepen in den Jahren 1911-1912. Zoologische Jahrbücher Abteilung
für Systematik Ökologie und Geographie der Tiere 36: 1-148.
35. Smith, F. 1860. Descriptions of new species of hymenopterous insects collected by Mr. A. R.
Wallace at Celebes. Journal of the Proceedings of the Linnean Society of London,
Zoology 5: 57-93.
36. Santschi, F. 1914. Voyage de Ch. Alluaud et R. Jeannel en Afrique Orientale, 1911-1912.
Résultats scientifiques. Insectes Hyménoptères. II. Formicidae. Paris: Libr. A. Schulz, pp.
41-148.
37. Wheeler, W. M., 1922. Ants of the American Museum Congo expedition. A contribution to
the myrmecology of Africa. II. The ants collected by the American Museum Congo
Expedition. Bulletin of the American Museum of Natural History 45: 39-269.
38. André E (1887) Description de quelques fourmis nouvelles ou imparfaitement connues.
Revue d'Entomologie (Caen) 6: 280-298.
39. Patek SN, Baio JE, Fisher BL, Suarez AV (2006) Multifunctionality and mechanical origins:
Ballistic jaw propulsion in trap-jaw ants. Proceedings of the National Academy of
Sciences of the United States of America 103: 12787-12792.
40. Smith MA, Wood DM, Janzen DH, Hallwachs W, Hebert PDN (2007) DNA barcodes affirm
that 16 species of apparently generalist tropical parasitoid flies (Diptera, Tachinidae) are
not all generalists. Proceedings of the National Academy of Sciences of the United States
of America 104: 4771-4772.
41. Smith MA, Woodley NE, Janzen DH, Hallwachs W, Hebert PDN (2006) DNA barcodes
reveal cryptic host-specificity within the presumed polyphagous members of a genus of
parasitoid flies (Diptera : Tachinidae). Proceedings of the National Academy of Sciences
of the United States of America 103: 3657-3662.
42. Seifert KA, Samson RA, Dewaard JR, Houbraken J, Levesque CA, et al. (2007) Prospects for
fungus identification using C01 DNA barcodes, with Pénicillium as a test case.
Proceedings of the National Academy of Sciences of the United States of America 104:
3901-3906.
43. Sonnenberg R, Nolte AW, Tautz D (2007) An evaluation of LSU rDNA D1-D2 sequences
for their use in species identification. Frontiers in Zoology 4.
44. Doums C, Cabrera H, Peeters C (2002) Population genetic structure and male-biased
dispersal in the queenless ant Diacamma cyaneiventre. Molecular Ecology 11: 2251-
2264.
45. Giraud T, Blatrix R, Poteaux C, Solignac M, Jaisson P (2000) Population structure and
mating biology of the polygynous ponerine ant Gnamptogenys striatula Brazil. Molecular
Ecology 9: 1835-1841.
46. Ross KG, Krieger MJB, Shoemaker DD, Vargo EL, Keller L (1997) Hierarchical analysis of
genetic structure in native fire ant populations: results from three classes of molecular
markers. Genetics 147: 643-655.
27
47. Crandall KA, Bininda-Emonds ORP, Mace GM, Wayne RK (2000) Considering
evolutionary processes in conservation biology. Trends in Ecology & Evolution 15: 290-
295.
48. Harris JD, Froufe E (2005) Taxonomic inflation: species concept or historical geopolitical
bias? Trends in Ecology & Evolution 20: 6-7.
49. Isaac NJB, Mallet J, Mace GM (2004) Taxonomic inflation: its influence on macroecology
and conservation. Trends in Ecology & Evolution 19: 464-469.
50. Caccone A, Sbordoni V (2001) Molecular biogeography, evolutionary rates, and
morphological adaptations to cave life: a case study using Bathysciine beetles and
sequence data from the mitochondria CO1 gene. Evolution 55: 122-130.
51. Farrell BD (2001) Evolutionary assembly of the milkweed fauna: cytochrome oxidase 1 and
the age of Tetraopes beetles. Molecular Phylogenetics and Evolution 18: 469-478.
52. Dick CW, Roubik DW, Gruber KF, Bermingham E (2004) Long-distance gene flow and
cross-Andean dispersal of lowland rainforest bees (Apidae: Euglossini) revealed by
comparative mitochondrial DNA phylogeography. Molecular Ecology 13: 3775-3785.
53. Hebert PDN, Ratnasingham S, deWaard JR (2003) Barcoding animal life: cytochrome c
oxidase subunit 1 divergences among closely related species. Proceedings of the Royal
Society of London Series B-Biological Sciences 270: S96-S99.
54. Bensasson D, Zhang D, Hartl DL, Hewitt GM (2001) Mitochondrial pseudogenes:
evolution's misplaced witnesses. Trends in Ecology & Evolution 16: 314-321.
55. DeSalle R, Amato G (2004) The expansion of conservation genetics. Nature Reviews
Genetics 5: 702-712.
56. Hebert PD, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one:
DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes
fulgerator. Proceedings of the National Academy of Sciences of the United States of
America 101: 14812-14817.
57. Hajibabaei M, deWaard JR, Ivanova NV, Ratnasingham S, Dooh R, et al. (2005) Critical
factors for the high volume assembly of DNA barcodes. Philosophical Transactions of
the Royal Society of London B Biological Sciences.
58. Hajibabaei M, Janzen DH, Burns JM, Hallwachs W, Hebert PDN (2006) DNA barcodes
distinguish species of tropical Lepidoptera. Proceedings of the National Academy of
Sciences of the United States of America 103: 968-971.
59. Simon C, Frati F, Beckenbach A, Crespi B, Liu H, et al. (1994) Evolution, Weighting, and
Phylogenetic Utility of Mitochondrial Gene-Sequences and a Compilation of Conserved
Polymerase Chain-Reaction Primers. Annals of the Entomological Society of America
87: 651-701.
60. Smith MA, Fisher BL, Hebert PDN (2005) DNA barcoding for effective biodiversity
assessment of a hyperdiverse arthropod group: the ants of Madagascar. Philosophical
Transactions of the Royal Society B-Biological Sciences 360: 1825-1834.
61. Ji Y-J, Zhang D-X, He L-J (2003) Evolutionary conservation and versatility of a new set of
primers for amplifying the ribosomal internal transcribed spacer regions in insects and
other invertebrates. Molecular Ecology Notes 3: 581-585.
62. Saux C, Fisher BL, Spicer GS (2004) Dracula ant phylogeny as inferred by nuclear 28S
rDNA sequences and implications for ant systematics (Hymenoptera : Formicidae :
Amblyoponinae). Molecular Phylogenetics and Evolution 33: 457-468.
28
63. Hillis DM, Dixon MT (1991) Ribosomal DNA: Molecular Evolution and Phylogenetic
Inference. Quarterly Review of Biology 66: 411-453.
29
Figure Captions
Figure 1, oblique dorsal view of head. A, Anochetus madagascarensis. B, Odontomachus
coquereli.
Figure 2, Anochetus spp. full face and lateral view. A-B, boltoni worker CASENT0104542. C-
D, boltoni male CASENT0063847. E-F, goodmani worker CASENT0104543. G-H, goodmani
ergatoid queen CASENT0454531.
Figure 3, Anochetus grandidieri full face and lateral view. A-B, large worker
CASENT0497580. C-D, small worker CASENT0033463. E-F, large queen CASENT0041177.
G-H, small queen CASENT0498467. I-J, male CASENT0049858.
Figure 4, Anochetus madagascarensis full face and lateral view. A-B, worker
CASENT0104547. C-D, queen CASENT0498419. E-F, male CASENT0049282.
Figure 5, Anochetus workers, upper part of petiole from front view. A, boltoni
CASENT0104542. B, goodmani CASENT0104543. C, grandidieri (large form)
CASENT0497580. D, madagascarensis CASENT0498309.
Figure 6, collection localities of Anochetus specimens in Madagascar. Map shows major
ecoregions: east (light gray): rainforest, central (dark gray): montane forest; west (white):
tropical dry forest; southwest (medium gray): desert spiny bush thicket.
Figure 7, Anochetus pattersoni. A-D Worker holotype CASENT0102280 full face, lateral view,
upper part of petiole from rear view, dorsal view. E-F, queen paratype CASENT0103343 full
face and lateral view. G-H, male CASENT0172617 full face and lateral view.
Figure 8, Anochetus males, terminalia, lateral view. A, boltoni CASENT0063847. B,
grandidieri CASENT0080660. B, madagascarensis CASENT0063421. D, pattersoni
CASENT0172617.
Figure 9. NJ tree of K2P for five species of Anochetus in Madagascar, Comoros and
Aldabra (all specimens with > 500 bp). Deep divergences evident between madagascarensis,
grandidieri, and goodmani are evident. Deep divergences within A. goodmani are evident (In this
tree, A. boltoni falls within goodmani). The rightmost column of colors differentiate which
biogeographical groupings of Wilmé et al. [29] these populations fall.
WCE-1 = Binara, Antsahabe
WCE-12 = Andavakoera, Ankarana
WCE-7 = Kirindy Mite
WRDW-B = Vazimba, Androngonibe, Andranopasazy
Figure 10, Odontomachus spp. full face and lateral view. A-B, coquereli worker
CASENT0009409. C-D, coquereli ergatoid queen CASENT 0104947. E-F, troglodytes worker
CASNET0047308. G-H, troglodytes dealate queen CASENT0100313.
30
Figure 11 Odontomachus spp. males full face, lateral view, and oblique lateral view of
terminalia. A, B, and E, coquereli CASENT0063858. C, D, and F, troglodytes
CASENT0096412.
Figure 12, Odontomachus simillimus full face and lateral view. A-B, worker
CASENT0172667. C-D, queen CASENT0172668. E-F, male CASENT0172666.
Figure 13, Odontomachus spp. ventral aspect of posterior mesosoma viewed from
underneath and from rear with coxa and petiole removed to show metasternal process. A,
troglodytes CASENT0009961. B, simillimus CASENT0009988. C, coquereli CASNET0009962.
Figure 14, collection localities of Odontomachus in Madagascar. Map shows major
ecoregions: east (light gray): rainforest, central (dark gray): montane forest; west (white):
tropical dry forest; southwest (medium gray): desert spiny bush thicket.
Figure 15, NJ tree of K2P for three species of Odontomachus in Madagascar and Africa (all
specimens with > 500 bp). Deep divergences evident between coquereli, troglodytes, and
simillimus are evident. Deep divergences within O. coquereli are apparent. The rightmost
column of colors differentiate which biogeographical groupings of Wilme et al [29] these
populations fall.
WCE-1 = Binara
WCE-10 = Manongarivo
WCE-2 = Mahavelona, Kalalao, Betampona, Mananara-Nord, Marojejy, Anjanaharibe
WRDW-a2 = Akirindro, Ambanitaza, Anjanaharibe
Figure 16, Anochetus spp. CO1 DNA barcode heterogeneity. A. grandidieri (n=113), A.
madagascarensis (n=115), A. goodmani (n=47), A. boltoni (n=12) and A. pattersoni (n=3).
Figure 17, Odontomachus spp. CO1 DNA barcode heterogeneity. O. coquereli (n=97), O.
troglodytes (n=53) and O. simillimus (n=13).
31
Table 1: Primers used to generate sequences and molecular tests.
|
Primer Name |
Primer sequence (5'- 3') |
Amplicon |
Primer source |
Used for sequencing (Y/N) |
|
LepF1 |
ATTCAACCAATCATAAAGATATTGG |
CO1 |
[56] |
Y |
|
LepR1 |
TAAACTTCTGGATGTCCAAAAAATCA |
CO1 |
[56] |
Y |
|
MLepF1 |
GCTTTCCCACGAATAAATAATA |
CO1 |
[57] |
Y |
|
MLepR1 |
CCTGTTCCAGCTCCATTTT |
CO1 |
[58] |
Y |
|
CANTMR1D- |
GGRGGRTARAYAGTTCATCCWGTWCC |
CO1 |
[Modified from 59] |
N |
|
C ANTMR1D- |
CAWCCWGTWCCKRMNCCWKCAT |
CO1 |
[Modified from 60] |
N |
|
CAS18Fs1 |
TACACACCGCCCGTCGCTACTA |
ITS1 |
[61] |
Y |
|
CAS5p8s1Bd |
ATGTGCGTTCRAAATGTCGATGTTCA |
ITS1 |
[Modified from 61] |
Y |
|
D2B |
GTCGGGTTGCTTGAGAGTGC |
28S |
[62] |
Y |
|
D3Ar |
TCCGTGTTTCAAGACGGGTC |
28S |
[62] |
Y |
|
18H3 |
AGGGTCGATTCCGGAGAGGGAGCCTGAGAA |
18S |
[63] |
Y |
|
185WR |
CTTGGCAAATGCTTTCGC |
18S |
[63] |
Y |
|
wsp 81F |
TGGTCCAATAAGTGATGAAGAAAC |
Wolbachia surface protein |
[20] |
Y |
|
wsp 691R |
AAAAATTAAACGCTACTCCA |
Wolbachia surface protein |
[20] |
Y |
32
|
Parc National de Kirindy |
Parc National Tsingy de |
Reserve Speciale de |
Antsahabe 550 |
Antsahabe 550 |
Antsahabe 550 |
l'Ankarana |
l'Ankarana |
l'Ankarana |
Antsahabe 550 |
Antsahabe 550 |
Antsahabe 550 |
||
|
Parc National de |
|||||||||||||
|
Kirindy |
CASENT0015325 |
7 |
17 |
38 |
38 |
39 |
40 |
44 |
43 |
39 |
41 |
39 |
|
|
Parc National |
CASENT0432938 |
0.01101 |
16 |
37 |
37 |
38 |
41 |
45 |
44 |
38 |
40 |
38 |
|
|
Réserve Spéciale de |
CASENT0022239 |
0.02704 |
0.02541 |
42 |
42 |
43 |
40 |
44 |
43 |
43 |
45 |
43 |
|
|
Forêt d'Antsahabe |
CASENT0499942 |
0.0618 |
0.06009 |
0.0686 |
- |
0 |
11 |
32 |
37 |
35 |
11 |
13 |
11 |
|
Forêt d'Antsahabe |
CASENT0498310 |
0.0618 |
0.06009 |
0.0686 |
0 |
- |
11 |
32 |
37 |
35 |
11 |
13 |
11 |
|
Forêt d'Antsahabe |
CASENT0076507 |
0.06349 |
0.06178 |
0.0703 |
0.01737 |
0.01737 |
- |
32 |
35 |
35 |
0 |
2 |
0 |
|
Réserve Spéciale de |
CASENT0499020 |
0.06516 |
0.06686 |
0.06515 |
0.05168 |
0.05168 |
0.0517 |
7 |
17 |
32 |
34 |
32 |
|
|
Réserve Spéciale de |
CASENT0428100 |
0.07205 |
0.07374 |
0.07203 |
0.06019 |
0.06019 |
0.05681 |
0.01103 |
22 |
35 |
37 |
35 |
|
|
Réserve Spéciale de |
CASENT0505299 |
0.07032 |
0.07201 |
0.07028 |
0.0567 |
0.0567 |
0.05672 |
0.02704 |
0.03528 |
35 |
37 |
35 |
|
|
Forêt d'Antsahabe |
CASENT0053814 |
0.06688 |
0.06517 |
0.07373 |
0.02057 |
0.02057 |
0.00313 |
0.05504 |
0.06016 |
0.06008 |
- |
2 |
0 |
|
Forêt d'Antsahabe |
CASENT0053785 |
0.06349 |
0.06178 |
0.0703 |
0.01737 |
0.01737 |
0 |
0.0517 |
0.05681 |
0.05672 |
0.00313 |
- |
2 |
|
Forêt d'Antsahabe |
CASENT0053884 |
0.06349 |
0.06178 |
0.0703 |
0.01737 |
0.01737 |
0 |
0.0517 |
0.05681 |
0.05672 |
0.00313 |
0 |
- |
Table 2: Anochetus goodmani within-species pair-wise partitioning of genetic variance for the CO1 DNA barcode. K2P distances are beneath the diagonal and
the number of substitutions are above the diagonal.
33
34
Table 3: Comparison of the utility of various complimentary nuclear markers for species diagnosis in the ponerine ants of the
Malagasy.
Taxa 18S 28S ITS1 Comments
|
Taxa |
18S |
28S |
ITS1 |
Comments |
|
Anochetus |
Intra - no variation. |
Intra - no variation |
Intra - extreme variation (length and |
rRNA is, a priori, difficult to |
|
Anochetus |
Intra - no variation. |
N/A |
Intraspecific variation of 1% (indels |
|
|
Anochetus |
N/A |
Intra - no variation. goodmani. |
Intra - variation that does NOT reflect |
rRNA is, a priori, difficult to -Positive Wolbachia test. |
|
Anochetus |
N/A |
N/A |
Low intraspecific variation that does |
- Positive Wolbachia test. |
|
Anochetus pattersoni |
N/A |
N/A |
N/A |
|
|
Odontomachus |
Intra - no variation. |
Intra - variation. |
Intraspecific variation that only |
35
36
|
from A. goodmani. |
distribution. |
|||
|
Odontomachus |
Intra - no variation. |
Intra - some |
Intraspecific variation that only |
All specimens tested positive |
|
Odontomachus |
N/A |
Intra - no variation. |
N/A |